1. Introduction
With dramatic changes in diets and lifestyles, nonalcoholic fatty liver disease (NAFLD) has become one of the most prevalent causes of chronic liver disease, affecting more than a quarter of the adult population worldwide [
1], [
2]. Approximately 30% of patients with NAFLD progress to nonalcoholic steatohepatitis (NASH), potentiating the development of life-threatening liver fibrosis and hepatocellular carcinoma (HCC) [
3]. Notably, fibrosis severity is the strongest histological predictor of liver-related morbidity and mortality in patients with NASH [
4], [
5]. Liver fibrosis is characterized by the activation of hepatic stellate cells (HSCs) and the excessive accumulation of extracellular matrix. The activation of HSCs can be mediated by diverse extracellular signals from both parenchymal cells and nonparenchymal cells (NPCs), including hepatocytes, liver sinusoidal cells (LSECs), and macrophages [
6], [
7], [
8]. In particular, macrophages are crucial regulators of liver inflammation and the progression of liver fibrosis [
9]. Currently available clinical antifibrotic therapies that directly modulate HSC activation are limited. Therefore, delineating the profibrotic crosstalk between HSCs and other hepatic cells may identify novel targetable pathways to combat NASH-related fibrosis.
Pyruvate kinase (PK) catalyzes the final step of glycolysis by converting phosphoenolpyruvate to pyruvate. There are four isozymes of PKs, including PKL, PKR, PKM1, and PKM2 [
10]. Unlike other PK isoforms that only function as hyperactive tetramers, PKM2 contains a less active dimeric form, which shifts the metabolic flux from oxidative phosphorylation to aerobic glycolysis. In addition, the PKM2 dimer can translocate to the nucleus and act as a transcriptional coactivator to regulate gene expression [
11]. Owing to these unique properties, PKM2 is involved in the metabolic reprogramming of immune cells, which requires enhanced aerobic glycolysis upon activation [
12]. Recent studies have highlighted the involvement of PKM2 in inflammatory diseases. Myeloid PKM2 deletion suppresses glycolysis and the inflammatory response of circulating macrophages, thereby reducing atherosclerosis [
13]. Ablation of PKM2 in macrophages protects mice from lethal endotoxemia and sepsis by inhibiting the secretion of proinflammatory cytokines [
14]. Growing evidence indicates that PKM2 contributes to the progression of inflammatory liver diseases [
15], [
16], [
17]. PKM2 expression is upregulated in steatotic livers, and cell-specific PKM2 knockout reverses T helper 17 cell (Th17)-mediated liver injury and NAFLD severity [
18]. In the setting of NASH, several synthetic compounds ameliorate steatohepatitis by modulating macrophage polarization mediated by PKM2 [
19], [
20], [
21]. Nuclear translocation of PKM2 promotes macrophage M1 polarization in NASH [
22]. We previously reported that PKM2 critically regulates HSC activation and proliferation [
23]. However, studies investigating the role of PKM2 in NASH fibrosis are limited, and it remains unclear whether PKM2 can serve as a druggable target for NASH fibrosis.
Heteroduplex oligonucleotides (HDOs), comprising an antisense oligonucleotide (ASO) and its complementary RNA (cRNA) strand, are powerful therapeutic tools that function by binding specific RNA-target sequences via Watson-Crick base pairing. HDOs cover a spectrum of applications, ranging from the degradation of RNA to the disruption of RNA-protein interactions [
24]. Specific chemical modifications of the phosphate backbone, ribose sugars, and nucleobases are used to enhance the
in vivo delivery efficacy and pharmacological properties of HDOs. Lipid components, including cholesterol, are mainly stored and metabolized in the liver. Given this advantage, cholesterol-conjugated HDOs (Cho-HDOs) preferentially accumulate in the liver, potentiating their application in liver-specific gene editing [
24], [
25].
The present study demonstrated that PKM2 was upregulated in NPCs, especially macrophages, in the livers of patients with fibrotic NASH. To determine the role of macrophage PKM2 in NASH fibrogenesis, macrophage-specific PKM2 knockout mice were generated. Deletion of PKM2 in macrophages significantly ameliorated hepatic inflammation and the progression of NASH fibrosis. In addition, the present study investigated whether Cho-HDOs can be used to modulate gene expression in liver macrophages and other NPCs in the context of NASH. Cho-HDOs efficiently decreased hepatic and macrophagic PKM2 expression in a dose-dependent manner, thereby ameliorating NASH fibrosis progression. Overall, the present study identified PKM2 as a potential pharmacological target for treating NASH-related fibrosis. The therapeutic modulation of PKM2 by Cho-HDOs can serve as an effective strategy for combating NASH-related fibrosis.
2. Methods
2.1. Human liver samples
Paraffin-embedded human liver samples from patients diagnosed with NASH (who underwent liver biopsy) and individuals with hepatic hemangioma (negative controls) were obtained from the First Affiliated Hospital of Jinan University, China. The control individuals had no history of viral hepatitis, alcohol addiction, or other liver disease. Human liver samples were collected after obtaining written informed consent, and ethical approval was obtained from the Institutional Ethics Committee of the First Affiliated Hospital of Jinan University.
2.2. Mice and treatment
Mice were maintained in a specific pathogen-free environment with a 12 h light-dark cycle starting at 7 a.m. and a constant temperature of 22-24 °C. PKM2FL/FL and LysM-Cre mice were obtained from Jackson Laboratory (USA), and C57BL/6 mice were purchased from Guangzhou Ruige Biological Technology Co., Ltd. (China). Macrophage-specific PKM2 knockout (PKM2ΔMAC) mice were generated by crossing PKM2FL/FL mice with LysM-Cre mice (all on a C57BL/6 background).
The following primers were used for genotyping (5′-3′): CCTTCAGGAAGACAGCCAAG and AGTGCTGCCTGGAATCCTCT for PKM2FL/FL; and CCCAGAAATGCCAGATTACG, CTTGGGCTGCCAGAATTTCTC, and TTACAGTCGGCCAGGCTGAC for LysM-Cre.
To induce NASH and a mild fibrosis phenotype, 6- to 8-week-old male
PKM2ΔMAC and
PKM2FL/FL mice (
n = 6-8 per group) were randomly assigned to a methionine- and choline-deficient (MCD) diet (A02082002BR; Research Diets, Inc., USA) for four or eight weeks [
26], [
27].
To induce NASH with advanced fibrosis, 6- to 8-week-old male
PKM2ΔMAC and
PKM2FL/FL mice (
n = 6-8 per group) were randomly assigned to either a normal chow or high-fat high-cholesterol (HFHC) diet containing 42% fat, 42.7% carbohydrates, and 15.2% protein by caloric intake with an additional 2% cholesterol (Beijing Keao Xieli Feed Co., Ltd., China) for 16 weeks as previously described [
28].
To induce more severe NASH with advanced fibrosis and HCC, 9-week-old male
PKM2ΔMAC and
PKM2FL/FL mice (
n = 6-8 per group) were fed a western diet containing 21.1% fat, 41% sucrose, and 1.25% cholesterol by weight and a high-sugar water solution containing 23.1 g∙L
−1 D-fructose and 18.9 g∙L
−1 D-glucose (Beijing Solarbio Science & Technology Co., Ltd., China) for 12 or 24 weeks. This diet regimen was started simultaneously with weekly intraperitoneal (i.p.) injections of carbon tetrachloride (CCl
4; 0.2 μL∙g
−1 of body weight (BW); Tianjin Fuyu Fine Chemical Co., Ltd., China) as previously described [
29]. For the NASH-HCC group, mice underwent ultrasound analysis (VINNO 6 Lab, China) for the detection of HCC after 22 weeks of western diet plus weekly carbon tetrachloride injection (WD/CCl
4).
For ML265 (a PKM2 agonist; MedChemExpress, USA) treatment, 6- to 8-week-old male C57BL/6 mice (n = 6-10 per group) were administered ML265 (30 mg∙kg−1∙d−1 consecutively; i.p.) or vehicle (10% dimethyl sulfoxide (DMSO) + 90% (20% sulfobutylether-β-cyclodextrin (SBE-β-CD) in saline)) after ten weeks of HFHC diet feeding or six weeks of MCD diet feeding, respectively.
Food intake for HFHC-fed mice was measured over one week in a regular cage using racks, which were weighed every day, and weekly food intake was calculated as kcal per day within the time shown. The mice were fasted at the end of the experiment, and serum and tissues were harvested as previously described [
30]. The liver was excised and immediately weighed. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Jinan University and approved by the Animal Ethics Committee of Jinan University (animal ethical license No. 20230419-04). To avoid interference from estrogen and the menstrual cycle, only male animals were used in the present study.
2.3. Histology, immunohistochemistry (IHC), and immunofluorescence (IF)
Briefly, formalin-fixed, paraffin-embedded liver tissue samples (4 μm) were stained with hematoxylin and eosin (H&E) and picrosirius red (26357-02; Head (Beijing) Biotechnology Co., Ltd., China) or subjected to IHC analysis according to previously described standard protocols [
31], [
32]. For Oil Red O staining, frozen liver sections (10 μm) were rinsed with 60% isopropanol and then stained with Oil Red O solution (Sigma-Aldrich, USA) as previously described [
33]. All bright field images were captured with an Olympus BX51 fluorescence microscope. For IF staining, formalin-fixed, paraffin-embedded tissue sections or cells fixed with cold methanol were co-stained with the indicated primary antibodies and further detected with appropriate secondary antibodies (Thermo Fisher Scientific, USA) labeled with either Alexa 488 or Alexa 555 according to the manufacturer’s instructions. Nuclei were labelled with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). IF images were captured with a Zeiss LSM 880 confocal laser scanning microscope (Germany). Quantification of picrosirius red, IHC, Oil Red O, and IF staining was performed by ImageJ as previously described [
34]. The primary antibodies used in the present study are listed in Table S1 in Appendix A.
2.4. Histological examination
Two experienced liver pathologists evaluated the H&E-stained liver sections in a blinded manner. The NAFLD activity score (NAS) of each liver specimen was determined via histopathology. Patients with an NAS ≥ 5 were considered likely to have NASH.
2.5. HDOs
PKM2-directed Cho-HDOs, including ASO and cRNA strands, were synthesized by Tsingke Biotechnology Co., Ltd. (China). Detailed sequence information is shown in Table S2 in Appendix A. Cyanine 5 (Cy5) was covalently bound to the 5′ end of the ASO, while cholesterol was conjugated to the 5′ end of the cRNA strand. To generate Cho-HDOs, equimolar concentrations of ASO and cRNA strands were dissolved and mixed in the appropriate solvent (phosphate buffered saline (PBS) for in vitro study; saline for in vivo study), which were then annealed at 95 °C for 5 min and then cooled to 37 °C for 1 h. For in vivo studies, single doses of 1 and 10 mg∙kg−1 PKM2-directed Cho-HDOs were administered via tail vein injection after four weeks of MCD diet feeding, and therapeutic and knockdown efficacy were evaluated four weeks later. Optimal cutting temperature (OCT) compound-embedded frozen liver sections were subjected to IF staining, and primary hepatic cells were isolated for flow cytometry and quantitative polymerase chain reaction (qPCR) analysis.
2.6. Biochemical analyses
Briefly, the levels of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were determined using an automated chemical analyzer (Rayto Life and Analytical Sciences Co., Ltd., China). Hepatic triglyceride (TG) levels were detected with a commercial kit (Sangon Biotech (Shanghai) Co., Ltd., China) according to the manufacturer’s instructions.
2.7. Mouse primary cell isolation, cell culture, and treatment
As previously described [
35], mouse bone marrow collected from the femurs and tibias of mice was cultured with 10 ng∙mL
−1 macrophage colony-stimulating factor (M-CSF; 315-02; PeproTech, Inc., USA) in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) for 7 d for bone marrow-derived macrophage (BMDM) differentiation. BMDMs were treated with lipopolysaccharide (LPS; 10 ng∙mL
−1; Sigma-Aldrich) and interferon-γ (IFN-γ; 25 ng∙mL
−1; PeproTech, Inc.) for 16 h to induce a proinflammatory phenotype in macrophages [
35]. 2-Deoxy-
D-glucose (2-DG, an inhibitor of glycolysis; S4701; Selleck Chemicals, USA), lactate (a byproduct of glycolysis; L8601; Beijing Solarbio Science & Technology Co., Ltd.), imoxin, C16 (C16, imidazolo-oxindole PKR inhibitor; HY-13977A; MedChemExpress), ML265 (HY-18657; MedChemExpress), or MCC950 (an NLRP3 inhibitor; HY-12815A; MedChemExpress) was added to pretreat the cells before LPS induction as previously described [
14], [
36], [
17].
Mouse primary HSCs were isolated according to previously described methods [
31]. Briefly, mouse livers were continuously perfused and digested
in situ with ethylene glycol tetraacetic acid (EGTA) solution, collagenase D (Roche, Switzerland) solution, and pronase (Sigma-Aldrich) solution. The liver was then harvested, minced, homogenized, and further digested
ex vivo with a buffer containing collagenase D, proteinase, and deoxyribonuclease (DNase; Roche). Finally, the digested liver was filtered through a 70 μm steel mesh, and cells were then separated by density gradient centrifugation.
For the coculture system involving BMDMs and primary HSCs, HSCs were pretreated with 1 ng∙mL
−1 transforming growth factor-β (TGF-β) to ensure basal activation as previously described [
6]. HSCs (5 d after isolation) were then stimulated with conditioned medium collected from short hairpin RNA targeting PKM2 (shPKM2)- or shScramble-transfected BMDMs primed with LPS/IFN-γ in the presence or absence of MCC950 (10 µmol∙L
−1). Lentiviral particles containing shPKM2 were obtained from GeneChem (China). The sequences are shown in Table S2.
The immortalized human myeloid leukemia monocytes (THP-1) cell line was purchased from Wuhan Procell Life Science & Technology Co., Ltd. (China) and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, USA) supplemented with 10% FBS and 1% penicillin-streptomycin. The immortalized human HSC LX-2 cell line was purchased from the Cell Bank established by the Chinese Academy of Sciences (China) and cultured in DMEM supplemented with 10% FBS. Both cell lines were identified by polymorphic short tandem repeat (STR) profiling and routinely tested to exclude mycoplasma contamination. THP-1 cells were differentiated into macrophages with 20 ng∙mL−1 phorbol 12-myristate 13-acetate (PMA; AbMole BioScience, USA) for 48 h, and the macrophages were used in subsequent experiments.
For the coculture system involving THP-1 and LX-2 cells, LX-2 cells were stimulated with conditional medium (CM) from LPS-stimulated THP-1 macrophages pretreated with or without ML265 and MCC950, and the activation status of LX-2 cells was then assessed.
2.8. qPCR
Total RNA was extracted from the indicated liver tissues or cells using TRIzol reagent (Invitrogen, USA). The total RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer. A PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Japan) was used to synthesize complementary DNA (cDNA) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific). The amplification conditions were as follows: 94 °C for 3 min; 40 cycles of 95 °C for 20 s, 60 °C for 40 s, and 72 °C for 20 s; and elongation at 72 °C for 5 min. The target messenger RNA (mRNA) levels were normalized to the levels of the β-actin housekeeping gene, which was used as the endogenous control. The PCR primers used in the present study were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences of the primers used are listed in Table S2.
2.9. Western blot analysis
Liver tissues and cells were lysed with ice-cold radioimmunoprecipitation assay (RIPA) lysis buffer (P0013B; Beyotime Biotechnology, China) supplemented with protease and phosphatase inhibitors, and the lysates were centrifuged at 14 000 r∙min−1 for 15 min. The protein concentrations were measured with a bicinchoninic acid (BCA) kit (23225; Thermo Fisher Scientific), and the protein samples were prepared using 4× sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer. Equal amounts of proteins were loaded onto 10% SDS-PAGE gels, and the separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes (3010040001; Roche). The membranes were blocked with 5% skim milk in tris buffered saline with Tween 20 (TBST) and incubated with the indicated primary antibodies at 4 °C overnight. The membranes were then washed and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature. Finally, the bands were detected using an enhanced chemiluminescence (ECL) kit (170-5061; Bio-Rad Laboratories, Inc., USA) and quantified with a ChemiDoc MP imaging system (Bio-Rad Laboratories, Inc.). The antibodies used for Western blot analysis are listed in Table S1.
2.10. Isolation and single-cell RNA sequencing (scRNA-seq) analysis of liver NPCs
Liver NPCs from
PKM2ΔMAC and
PKM2FL/FL mice fed an MCD diet for eight weeks were isolated as previously described [
37] and then subjected to scRNA-seq. The cell suspension was loaded into chromium microfluidic chips with 3′ chemistry (v2 or v3, depending on the project) and barcoded with a 10X chromium controller (10X Genomics, USA). RNA from the barcoded cells was subsequently reverse-transcribed, and sequencing libraries were constructed with reagents from a chromium single cell 3′ reagent kit (v2 or v3, depending on the project; 10X Genomics) according to the manufacturer’s instructions. Sequencing was performed with an Illumina HiSeq 2000 or NovaSeq (depending on the project) according to the manufacturer’s instructions (Illumina, Inc., USA). Data analysis was performed as previously described [
38], [
39].
2.11. Fluorescence-activated cell sorting (FACS) analysis
Liver NPCs from PKM2ΔMAC and PKM2FL/FL mice fed an MCD diet for eight weeks, as well as Cho-HDO-treated MCD diet-fed mice were isolated and further processed for flow cytometric analysis. Cells were incubated with a cluster of differentiation 16 (CD16)/CD32 Fc block prior to staining. A combination of fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD45 (553079; BD Biosciences, USA), phycoerythrin (PE)-conjugated anti-cyanine7-conjugated anti-mouse CD45 (103114; BioLegend, Inc., USA), PE-conjugated anti-mouse F4/80 (565410; BD Biosciences), Alexa Fluor 647-conjugated rat anti-mouse F4/80 (565854; BD Biosciences), FITC-conjugated anti-mouse CD11b (557396; BD Biosciences), and PE-conjugated anti-mouse Ly-6C (128007; BioLegend, Inc.) was used to reveal the effects of macrophage PKM2 depletion on Ly6Chigh macrophage infiltration and the delivery efficacy of Cho-HDOs in vivo.
2.12. RNA sequencing and analysis
LPS/IFN-γ-stimulated BMDMs from PKM2ΔMAC and PKM2FL/FL mice were subjected to RNA sequencing analysis (n = 3 per group). Total RNA was extracted from cells with TRIzol reagent. cDNA libraries were constructed for each pooled RNA sample using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) in accordance with the manufacturer’s instructions. Significant pathways of the differentially expressed genes (DEGs) were analyzed according to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.
2.13. Extracellular acidification rate (ECAR) monitoring
A Seahorse XFe96 Extracellular Flux Analyzer (Agilent Technologies, USA) was used for real-time recording of the ECAR. Briefly, BMDMs extracted from
PKM2ΔMAC and
PKM2FL/FL mice were seeded in Seahorse XF-96 microplates (4 × 10
5 cells∙well
−1) and treated with/without LPS/IFN-γ for 16 h. Before analysis, the cells were switched to ECAR medium for 1 h at 37 °C. After baseline measurements, 10 mmol∙L
−1 glucose, 1 μmol∙L
−1 oligomycin, and 50 mmol∙L
−1 2-DG were sequentially injected at the indicated time points as previously described [
17].
2.14. Enzyme-linked immunosorbent assay (ELISA)
The hepatic levels of cytokines, including monocyte chemoattractant protein 1 (MCP1; Sangon Biotech (Shanghai) Co., Ltd.) and collagen type I alpha 1 (COL1A1; ELK Biotechnology Co., Ltd., China), in mice and the concentrations of cytokines released by human and murine cells, including interleukin-1β (IL-1β), IL-18, high-mobility group box 1 (HMGB1; Sangon Biotech (Shanghai) Co., Ltd.), tissue inhibitor of metalloproteinase 1 (TIMP1; Wuhan Abebio Science Co., Ltd., China), and COL1A1, were detected with the indicated ELISA kits according to the manufacturer’s instructions. Extracellular levels of lactate were determined using a lactate assay kit (BioVision, USA) according to the manufacturer’s instructions.
2.15. Statistical analyses
The data are expressed as the means ± standard deviations (SDs). Statistical analyses were performed using GraphPad Prism Version 9.0. All the data were analyzed using two-tailed Student’s t tests or one-way analysis of variance (ANOVA). P ≤ 0.05 was considered to indicate a significant difference.
3. Results
3.1. PKM2 is upregulated in NPCs in the livers of patients with fibrotic NASH
To investigate the role of PKM2 in NASH fibrosis, a human dataset from a previous study, comprising 206 NAFLD/NASH patients and ten control patients (GSE135251), was analyzed. The mRNA level of
PKM, which encodes PKM1 and PKM2, was markedly increased in human NASH livers and was positively correlated with the NAS and fibrosis severity (
Fig. 1(a)). Western blot and IHC analyses revealed that PKM2, but not PKM1, was significantly upregulated in human and murine fibrotic NASH livers (
Fig. 1(b), Fig. S1 in Appendix A). IHC analysis indicated that PKM2 was upregulated in NPCs but not in hepatocytes. Analysis of publicly available scRNA-seq datasets [
37], [
40] and IF staining further revealed that PKM2 was upregulated in NPCs during NASH fibrosis progression, especially in macrophages (
Figs. 1(c) and (d), Fig. S2 in Appendix A). To characterize the contribution of macrophage PKM2 to NASH fibrogenesis, the expression of macrophage PKM2, CD11b (immune infiltration), and α-smooth muscle actin (α-SMA; HSC activation) was evaluated in an MCD diet-induced NASH model. Percentage of PKM2 positive macrophages was dynamically increased, accompanied by elevated levels of CD11b and α-SMA, suggesting that macrophage PKM2 plays an important role in modulating hepatic inflammation and NASH fibrosis progression (
Fig. 1(e)). Taken together, these data indicated that macrophage PKM2 contributes to NASH fibrogenesis.
3.2. Macrophage PKM2 deletion ameliorates steatohepatitis and fibrosis progression in MCD diet-induced NASH model mice
To determine the function of macrophage PKM2 in NASH fibrogenesis, myeloid-specific PKM2 knockout mice (
PKM2ΔMAC) were generated by crossing
PKM2FL/FL mice with
LysM-Cre mice (
Fig. 2(a)). The genotyping and knockout efficacy of PKM2 in macrophages were validated (
Fig. 2(b), Figs. S3(a)-(c) in Appendix A). Three murine NASH models with different etiologies were used to assess the effect of macrophage PKM2 depletion on NASH fibrosis (Fig. S3(d) in Appendix A).
To determine whether the deletion of PKM2 in macrophages protects against steatohepatitis,
PKM2ΔMAC and wild-type (
PKM2FL/FL) mice were challenged with an MCD diet for four weeks (
Fig. 2(c)) to generate a model that recapitulates most features of human NASH, including hepatocyte ballooning, Mallory-Denk body formation, and substantial immune infiltration [
38]. PKM2 deficiency effectively suppressed MCD diet-induced increases in liver weight (LW) and LW/BW (
Fig. 2(d)). In addition, the levels of serum ALT and AST in
PKM2ΔMAC mice fed the MCD diet were lower than those in
PKM2FL/FL mice (
Fig. 2(e)). Importantly,
PKM2ΔMAC mice fed the MCD diet displayed significantly reduced steatohepatitis, macrophage infiltration, and proinflammatory gene expression (
Tnfa, Il1b, Il6, Cxcl10, and
Mcp1) compared to control mice (
Figs. 2(f) and (g)). Macrophage has been recognized to regulate hepatocyte lipogenesis [
33], herein we further investigate whether the deletion of PKM2 in macrophages affects steatosis and lipid accumulation. Macrophage PKM2 deficiency effectively ameliorated steatosis and lipogenesis (Fig. S4 in Appendix A), as revealed by Oil Red O staining, liver TG content, lipogenesis-related gene expression (
Pparg,
Srebp-1c,
ChREBP, and
Fasn), and fatty acid degradation-related gene expression (
Ppara,
Acadl,
Acox, and
Cpt1a). These results demonstrated that macrophage PKM2 deletion protects against NASH development.
To induce NASH-related fibrosis, the MCD diet was extended from 4 to 8 weeks.
PKM2ΔMAC mice exhibited ameliorated steatohepatitis and fibrosis severity, as reflected by reduced NASs, collagen deposition, and HSC activation (
Fig. 2(h)). Moreover, the levels of genes involved in inflammation (
Tnfa, Il1b, Il6, Cxcl10, and
Mcp1) and fibrosis (
Tgfb1, Acta2, Col1a1, and
Timp1) were significantly lower in
PKM2ΔMAC mice than in control mice (
Fig. 2(i)). The protective effects of macrophage PKM2 deletion on NASH fibrosis were further confirmed by decreased levels of proinflammatory (MCP1) and profibrotic (COL1A1) mediators (
Fig. 2(j)). These data demonstrated that macrophage PKM2 plays a negative role in MCD diet-induced NASH fibrogenesis.
3.3. Macrophage PKM2 knockout protects mice from HFHC diet-induced NASH fibrosis
The above results revealed that macrophage PKM2 knockout protects against mild fibrosis in NASH. To further analyze the role of macrophage PKM2 in advanced NASH fibrosis,
PKM2ΔMAC and
PKM2FL/FL mice were challenged with HFHC diet (
Fig. 3 (a)). This model recapitulates the histological characteristics of human NASH with progressive fibrosis [
41].
Macrophage PKM2 deficiency blunted the increase in BW, LW, and the LW/BW ratio induced by the HFHC diet without affecting food intake (
Fig. 3(b), Figs. S5(a)-(d) in Appendix A). The serum levels of ALT and AST and liver TG in the
PKM2ΔMAC mice fed the HFHC diet were lower than those in the control mice (
Fig. 3(c), Fig. S5(e) in Appendix A). Moreover, the deletion of PKM2 in macrophages attenuated steatohepatitis, fibrosis severity, and HSC activation compared to control mice (
Fig. 3(d)). Consistent with the results found in the MCD diet-induced NASH model, the levels of genes and mediators related to inflammation and fibrosis were significantly lower in HFHC diet-fed
PKM2ΔMAC mice than in control mice (Figs. S5(f) and (g) in Appendix A). These findings revealed that macrophage PKM2 depletion ameliorates HFHC diet-induced advanced NASH fibrosis.
3.4. Macrophage PKM2 deficiency mitigates WD/CCl4-induced NASH fibrosis and subsequent HCC
Most patients with fibrotic NASH eventually develop cirrhosis (the end stage of liver fibrosis) and even HCC [
42]. To further explore the function of macrophage PKM2 in the transition from NASH fibrosis to HCC,
PKM2ΔMAC and
PKM2FL/FL mice were challenged with WD/CCl
4 to generate a more severe NASH model that induces rapid progression of advanced fibrosis (F3) at 12 weeks and HCC formation at 24 weeks (
Fig. 3(e)) [
29].
Compared to
PKM2FL/FL mice, the LW, LW/BW ratio, serum ALT level, and serum AST level in
PKM2ΔMAC mice were significantly lower after 12 weeks of WD/CCl
4 induction (
Figs. 3(f) and (g), Figs. S6(a) and (b) in Appendix A). Compared to PKM2
FL/FL mice,
PKM2ΔMAC mice exhibited significantly ameliorated steatohepatitis, fibrosis deposition, and HSC activation (
Fig. 3(h)). In addition, the levels of genes and factors implicated in inflammation and fibrosis were decreased in
PKM2ΔMAC mice (Figs. S6(c) and (d) in Appendix A). These data illustrated that macrophage PKM2 ablation efficiently reverses the progression of WD/CCl
4-induced NASH fibrosis.
Next, the effect of macrophage PKM2 knockout on WD/CCl
4-induced NASH-HCC was evaluated. All mice developed tumors at 24 weeks, displaying features of steatohepatitic HCC. Compared to control mice, macrophage PKM2 depletion significantly decreased the number of HCCs, particularly the number of larger tumors (diameter > 4 mm), indicating that PKM2 deletion suppresses the development and progression of liver neoplasms associated with NASH fibrosis/cirrhosis (
P < 0.001;
Fig. 3(i)). In addition, the number of Ki67-positive cells (within the tumor region) was lower in
PKM2ΔMAC mice than in control mice (
Fig. 3(j), Fig. S6(e) in Appendix A). Trem2
+ NASH-associated macrophages (NAMs) have been shown to induce CD8
+ T cell exhaustion and an immunosuppressive microenvironment during NASH-HCC development [
39]. The present study demonstrated that Trem2
+ NAMs (F4/80
+Gpnmb
+) were significantly diminished in
PKM2ΔMAC mice, thereby restoring exhausted PD1
+CD8
+ T cells (Fig. S6(f) in Appendix A). These findings suggested that macrophage PKM2 knockout reversed the tumor-prone microenvironment of NASH-HCC. Taken together, the present results demonstrated that macrophage PKM2 deficiency attenuates the progression of advanced NASH fibrosis and partially reverses subsequent HCC formation and development.
3.5. Deletion of PKM2 in macrophages reduces the number of profibrotic Ly6Chigh macrophages during NASH fibrogenesis
Because
PKM2ΔMAC mice displayed attenuated hepatic inflammation and fibrosis severity in NASH, the present study aimed to determine whether PKM2 advances NASH fibrogenesis by regulating macrophage activation. scRNA-seq analysis was performed on liver NPCs isolated from MCD diet-fed
PKM2ΔMAC and
PKM2FL/FL mice (
Fig. 4(a)). Clustering analysis classified liver NPCs into 11 clusters (
Fig. 4(b)). Uniform manifold approximation and projection analysis of NPCs revealed that the frequency of infiltrated monocyte-derived macrophages (MDMs) was significantly decreased in
PKM2ΔMAC mice (
Fig. 4(c)). IF staining confirmed that the number of MDMs (CLEC4F
−IBA1
+) was markedly decreased in
PKM2ΔMAC mice, whereas the number of resident Kupffer cells (KCs; CLEC4F
+IBA1
+) was comparable between MCD diet-fed
PKM2ΔMAC and
PKM2FL/FL mice (Fig. S7(a) in Appendix A). These results indicated that macrophage PKM2-mediated proinflammatory responses mainly rely on MDMs.
The subclusters of MDMs that were significantly affected by macrophage PKM2 ablation were further analyzed. MP0 macrophages were defined as profibrotic Ly6C
high macrophages (
Ly6c2,
Chil3,
F13a1, and
Fn1) [
39]. Macrophage PKM2 knockout effectively decreased the frequency of Ly6C
high MDMs (MP0), resulting in the downregulation of markers associated with HSC activation (
Timp1 and
Tgfb1) (
Figs. 4(d) and (e)). Flow cytometry analysis further verified that the number of Ly6C
high macrophages (CD11b
+F4/80
+Ly6C
high) was significantly decreased in MCD diet-fed
PKM2ΔMAC mice (
Fig. 4(f)), confirming that PKM2 promotes the progression of NASH fibrosis by inducing Ly6C
high MDMs. Compared to control mice,
PKM2ΔMAC mice displayed reduced neutrophil (Ly6G
+) infiltration and phosphorylation of signal transducer and activator of transcription 1 (STAT1; M1 macrophage marker) but increased phosphorylation of STAT6 (M2 macrophage marker), which may have attributed to attenuated hepatic inflammation caused by macrophage PKM2 deficiency (Figs. S7(b) and (c) in Appendix A). Collectively, the present results indicated that PKM2-mediated NASH fibrosis progression is associated with profibrotic Ly6C
high macrophages.
3.6. PKM2-dependent glycolysis orchestrates the macrophage proinflammatory response and NLRP3 activation
The mechanism through which PKM2 regulates macrophage activation was further examined. Enhanced glycolysis is a prerequisite for the macrophage proinflammatory response [
43]. In the present study,
PKM2ΔMAC BMDMs exhibited markedly suppressed glycolysis during proinflammatory activation (stimulated with LPS and IFN-γ), as reflected by a reduced ECAR and lactate release (Figs. S8(a) and b) in Appendix A). Western blot analysis confirmed that PKM2 deletion in macrophages downregulated the expression of proteins involved in glycolysis (Fig. S8(c) in Appendix A). Furthermore, the addition of 2-DG abolished the differences in the expression of macrophage M1 markers (
Tnfa, Il1β, and
Il6) and M2 marker (
Il10) caused by macrophage
Pkm2 ablation, suggesting that PKM2-mediated macrophage proinflammatory activation is glycolysis dependent (Fig. S8(d) in Appendix A). In addition, limiting the nuclear translocation of PKM2 by ML265 (also referred to as TEPP-46) inhibited macrophage activation, confirming that PKM2 nuclear translocation is pivotal for metabolic reprogramming and proinflammatory activation of macrophages (Fig. S8(e) in Appendix A) [
36]. Taken together, these results demonstrated that PKM2 promotes proinflammatory macrophage activation by reprogramming glycolysis.
To better characterize the role of PKM2 in macrophage proinflammatory activation, RNA sequencing (RNA-seq) was performed on BMDMs (stimulated with LPS and IFN-γ) isolated from
PKM2ΔMAC and
PKM2FL/FL mice (
Fig. 5 (a)). Macrophage PKM2 knockout significantly inhibited proinflammatory responses and cytokine production by macrophages, which downregulated several profibrotic genes, including
Nlrp3,
Il1b, and
Tgfb1 (Figs. 5(b)-(d)).
The present study next examined whether PKM2 promotes NASH fibrogenesis via NLRP3 signaling. Western blot analysis verified that macrophage PKM2 knockout inhibited NLRP3 activation in MCD diet-fed mice (
Fig. 5(e)). Protein kinase R (PKR) has been shown to regulate NLRP3 activation [
14]. Deletion of PKM2 suppressed PKR phosphorylation and NLRP3 activation both
in vivo and
in vitro (
Fig. 5(f)). To determine whether PKM2-mediated glycolysis is involved in NLRP3 activation, the expression of p-PKR and NLRP3 was measured in LPS-primed BMDMs stimulated with lactate. Consistent with previous studies [
14], [
44], the present study demonstrated that the addition of lactate significantly induced PKR phosphorylation and NLRP3 activation in LPS-stimulated macrophages (
Fig. 5(g)). Furthermore, ML265 and C16 reversed lactate-induced NLRP3 activation and the secretion of downstream cytokines, which indicated that PKM2-mediated glycolysis promoted NLRP3 activation in a PKR-dependent manner (
Figs. 5(h) and (i)). In addition, the deletion of PKM2 significantly inhibited the secretion of IL-1β, IL-18, and HMGB1 by BMDMs, and this inhibition was abolished by MCC950 (
Fig. 5(j)). These findings suggested that PKM2-dependent glycolysis promotes NLRP3 activation in macrophages, leading to the secretion of proinflammatory and profibrotic cytokines (
Fig. 5(k)).
3.7. Macrophage PKM2 induces HSC activation via NLRP3 signaling
HSC activation is the driving force for liver fibrosis progression. To assess whether macrophage PKM2 directly regulates HSC activation via NLRP3 signaling, mouse primary HSCs (on Day 5) were stimulated with CM collected from short hairpin RNA (shRNA)-transfected BMDMs treated with or without MCC950 (
Fig. 6(a), Fig. S8(f) in Appendix A). Stimulation with CM from LPS/IFN-γ-treated shScramble-transfected BMDMs promoted HSC activation, whereas PKM2 knockdown in BMDMs reversed this effect (
Figs. 6(b) and (c)). Moreover, the addition of MCC950 abolished the differences caused by macrophage PKM2 knockdown, as reflected by the qPCR and ELISA analyses (
Figs. 6(b) and (d)).
The profibrotic crosstalk mediated by NLRP3 was further validated in well-established human macrophage (THP-1) and HSC (LX-2) cell lines (
Fig. 6(e)). ML265 efficiently reversed PKM2 nuclear translocation in proinflammatory macrophages, thereby inhibiting the ability of PKM2 to promote HSC activation (Figs. 6(f)-(h)). Similar to the results observed in mouse primary cells, NLRP3 inhibition abolished the difference in the profibrotic crosstalk between human macrophages and HSCs caused by ML265 (
Figs. 6(f) and (h)). Collectively, these data demonstrated that macrophage PKM2 promotes HSC activation via NLRP3 signaling (
Fig. 6(i)).
3.8. Therapeutic modulation of PKM2 alleviates steatohepatitis and consequent liver fibrosis in mice
We previously reported that a PKM2 agonist exhibits better antifibrotic efficacy than a PKM2 inhibitor in CCl
4-induced murine liver fibrosis [
23]. Here, we assessed the therapeutic efficacy of ML265 on MCD diet- and HFHC diet-induced NASH fibrosis. First, we evaluated the effects of ML265 on HFHC diet-induced NASH fibrosis (Fig. S9(a) in Appendix A). ML265 treatment did not influence the BW of normal diet-fed mice but effectively blunted HFHC diet-induced increases in LW, BW, and LW/BW (Figs. S9(b)-(d) in Appendix A). Compared to control mice, the parameters related to liver function (serum ALT and AST) and lipid accumulation (liver TG) were significantly ameliorated in ML265-treated mice (Figs. S9(e) and (f) in Appendix A). Histopathological analysis revealed that ML265-treated HFHC diet-fed mice exhibited markedly reduced steatohepatitis, fibrosis deposition, and HSC activation compared to control mice (Fig. S9(g) in Appendix A). Moreover, the levels of markers implicated in the inflammatory response and liver fibrosis were lower in ML265-treated mice than in control mice, as revealed by ELISA (Fig. S9(h) in Appendix A). The therapeutic efficacy of ML265 was further confirmed in an MCD diet-induced NASH model (Fig. S10(a) in Appendix A). Consistent with the protective effect observed in the HFHC diet-induced NASH model, the PKM2 agonist markedly ameliorated changes in the LW/BW ratio, liver function (serum ALT and AST), lipid accumulation (liver TG), and liver histology, and it decreased the levels of cytokines involved in inflammation and fibrosis compared to no treatment (Fig. S10 in Appendix A). In addition, IF staining demonstrated that the PKM2 agonist shifted macrophages from the proinflammatory phenotype to the anti-inflammatory phenotype (Figs. S11(a) and (b) in Appendix A). Western blot analysis further confirmed that phosphorylation of STAT1 was inhibited by ML265 treatment, whereas phosphorylation of STAT6 was enhanced by ML265 treatment, indicating that limiting PKM2 nuclear translocation ameliorates NASH fibrosis by suppressing proinflammatory macrophage activation (Fig. S11(c) in Appendix A). These results suggested that the PKM2 agonist efficiently resolves NASH fibrosis by reversing the profibrotic crosstalk between macrophages and HSCs.
Given that PKM2 is also upregulated in other liver NPCs, including HSCs, LSECs, and T cells, in patients with fibrotic NASH, the ablation of hepatic PKM2 may improve outcomes in patients with NASH-related fibrosis. To test this hypothesis, Cho-HDOs, which preferentially accumulate in the liver, were used to deplete PKM2 in macrophages and other NPCs (
Fig. 7(a)). Given that PKM2 is significantly upregulated in HCC cells and immune cells [
15], we first validated the knockdown efficacy of Cho-HDO targeting PKM2 in Hepa 1-6 (hepatoma) cells and BMDMs, which represent liver parenchymal cells and NPCs, respectively. We found that Cho-HDO3 exhibited the best knockdown effect on the expression of PKM2 (but not PKM1) in a dose-dependent manner (Figs. S12(a) and (b) in Appendix A).
A significant accumulation of Cy5 signals
in vivo was observed at 24 h after tail vein injection (
Fig. 7(b)). To determine the therapeutic efficacy of Cho-HDOs in NASH fibrosis, two doses of Cy5-labeled Cho-HDOs were administered to MCD diet-fed mice. Flow cytometry analysis revealed significant Cy5 accumulation in the NPCs and hepatic macrophages of Cho-HDO-treated mice (
Fig. 7(c)). Notably, Cho-HDOs reduced hepatic PKM2 expression and macrophage PKM2 expression in a dose-dependent manner (
Fig. 7(d), Fig. S12(c) in Appendix A). Importantly, Cho-HDOs ameliorated NASH and NASH fibrosis progression in a dose-dependent manner, as revealed by reductions in serum ALT levels, serum AST levels, hepatic TG content, NAS, lipid droplet accumulation, collagen deposition, immune cell infiltration, HSC activation, proinflammatory mediator levels, and profibrotic mediator levels (Figs. 7(e)-(g), Figs. S12(d) and (e) in Appendix A). In addition, consistent with a previous study [
24], the present study demonstrated that Cho-HDOs did not cause significant toxicity to the liver, heart, or kidneys (Fig. S13 in Appendix A). Collectively, these results demonstrated that ablation of PKM2 in NPCs by Cho-HDOs ameliorates NASH fibrosis progression in a dose-dependent manner, suggesting that PKM2-directed Cho-HDOs may serve as an effective strategy to combat NASH fibrosis.
4. Discussion
PKM2 regulates the metabolic reprogramming of many liver NPCs, including macrophages, HSCs [
23], and T cells [
18], and it is involved in the progression of NASH by promoting macrophage M1 polarization [
22]. Given that not all patients with NASH necessarily develop significant fibrosis [
45], it remains elusive whether PKM2 contributes to NASH fibrosis progression. The present study provides
in vivo evidence that PKM2 critically advances NASH fibrogenesis by regulating macrophage proinflammatory activation. Further, genetic ablation of macrophage PKM2 in transgenic mice or inhibition of hepatic PKM2 by Cho-HDOs mitigates NASH fibrosis.
Macrophage-specific PKM2-deficient mice are less susceptible to diet-induced NASH fibrosis with mitigated hepatic inflammation. This finding aligns with previous reports that PKM2 is implicated in hepatic macrophage polarization in NASH [
20], [
22]. The present study further demonstrated that deletion of PKM2 in macrophages reduces the population of Ly6C
high macrophages, a macrophage subtype that has been widely recognized to promote liver fibrosis [
6], [
46]. Regarding the regulatory role of PKM2 in macrophage activation, several studies [
36], [
47] have demonstrated that PKM2 regulates macrophage metabolic reprogramming and proinflammatory activation via hypoxia-inducible factor-1α (HIF-1α). The present results showed that macrophages lacking PKM2 display inhibited glycolysis and decreased expression of HIF-1α, hexokinase 2 (HK2), and lactate dehydrogenase A (LDHA), verifying that PKM2 regulates the phenotypic skewing of macrophages by modulating glycolysis. Moreover, enhanced PKM1 expression was observed in the BMDMs of
PKM2ΔMAC mice. Given that PKM1 and PKM2 are encoded by the
Pkm gene and that exon 10 of the
Pkm gene was specifically deleted in the transgenic mice, this increase in PKM1 expression may be attributed to compensatory transcription of PKM1 pre-mRNA. In addition, PKM1 can induce oxidative phosphorylation, which may further skew macrophages toward the M2 phenotype.
As a member of the inflammasome family, NLRP3 is a key regulator of steatohepatitis and liver fibrosis [
33], [
48]. NLRP3-mediated proinflammatory responses in NASH are dependent mainly on myeloid lineages [
49], and NLRP3 overexpression induces chronic extramedullary myelopoiesis and infiltration of Ly6C
high macrophages in experimental steatohepatitis [
50]. The present results revealed that deletion of PKM2 in macrophages markedly inhibited NLRP3 activation, suggesting that the decrease in Ly6C
high MDMs in
PKM2ΔMAC mice may be partly attributed to the downregulation of macrophage NLRP3 signaling. NLRP3 regulates caspase 1 activation and the production of IL-1β and IL-18 [
14], both of which are well-recognized profibrotic cytokines [
49], [
51]. The present study demonstrated that macrophage PKM2 promotes HSC activation and NASH fibrosis via NLRP3 signaling.
PKM2-targeting drugs can be mainly classified into kinase inhibitors and agonists. When inhibitors suppress the formation of hyperactive PKM2 tetramers, agonists promote PKM2 tetramer formation, thereby restricting PKM2 nuclear translocation. Our previous study [
23] demonstrated that both a PKM2 agonist and inhibitor effectively ameliorate CCl
4-induced liver fibrosis, and the PKM2 agonist exhibits better antifibrotic efficacy than the PKM2 inhibitor, suggesting that PKM2 nuclear translocation is the leading mechanism that regulates HSC activation and fibrogenesis. Moreover, the ML265 PKM2 agonist has been shown to mitigate early steatohepatitis [
52]. In the present study, an agonist was administered to combat NASH-related fibrosis, which further validated the therapeutic effect of a PKM2 agonist on NASH fibrosis, indicating that the nuclear translocation of PKM2 may also represent a driving force of NASH fibrosis progression.
In recent years, PKM2-targeting therapies have been widely examined in basic research and clinical trials. Digoxin, a cardiac glycoside, ameliorates sterile inflammation by blocking PKM2-mediated HIF-1α transactivation [
19]. Currently, TP-1454, a novel PKM2 agonist, is being used in phase I studies for eliminating solid tumors, including HCC. In addition to therapeutic compounds, gene-based therapies for PKM2 have also shown great potential in preclinical studies. Nanoparticles carrying PKM2-small interfering RNA (siRNA) effectively inhibit tumor glycolysis and the progression of triple-negative breast cancer [
53]. Adeno-associated virus (AAV)-directed PKM2 ablation efficiently ameliorates neuroinflammation and neuronal loss in epilepsy [
54]. Moreover, targeting PKM splicing by ASO converts the protumor PKM2 isoform into an antitumor PKM1 isoform, effectively suppressing aerobic glycolysis and HCC progression [
55]. The present study demonstrated that PKM2-directed Cho-HDOs may serve as an effective strategy to combat NASH-related fibrosis. We previously reported that Cho-HDOs targeting TRAF-associated NF-κB activator (TANK)-binding kinase 1 (TBK1) efficiently limit cholangiocarcinoma progression and metastasis [
32]. Unlike traditional liver-directed gene therapy, which primarily affects liver parenchymal cells, Cho-HDOs have been shown to efficiently modulate gene expression in bile duct cells, macrophages, and lymphocytes [
56], [
57], [
58]. In the present study, Cho-HDOs efficiently entered and modulated gene expression in NPCs, including macrophages, in the livers of mice with NASH, indicating that Cho-HDOs may serve as a therapeutic platform for liver NPCs. Moreover, a high dose of Cho-HDOs (10 mg∙kg
−1) had greater antifibrotic efficacy than PKM2 knockout in macrophages, which may be partly attributed to PKM2 ablation in nonmacrophage NPCs, such as HSCs, neutrophils, and T cells.
In summary, the present results demonstrated that macrophage PKM2 promotes hepatic inflammation and the progression of NASH fibrosis by stimulating profibrotic Ly6Chigh macrophages via metabolic reprogramming. Targeting PKM2 in a macrophage-specific or liver-specific manner can effectively reverse NASH-related fibrosis. Cho-HDOs may serve as a therapeutic platform to modulate hepatic gene expression in the context of NASH and other chronic liver diseases.
5. Conclusions
The present study provides preclinical evidence regarding the regulatory role and therapeutic potential of PKM2 in NASH fibrosis beyond existing in vivo and in vitro models. The present study may help to establish PKM2 as a druggable target for NASH-related fibrosis and highlights that Cho-HDOs can serve as a pharmacological platform for the treatment of NASH-related fibrosis and other liver diseases.
Acknowledgments
This work was supported by the Key-Area Research and Development Program of Guangdong Province (2020B1111110004), the Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (2017BT01Y036), the Guangdong Major Project of Basic and Applied Basic Research (2023B0303000004), the National Natural Science Foundation of China (81871987, 82293680, 82293681, and 82273154), and the Guangdong Basic and Applied Research Foundation (2023A1515012905 and 2022A1515012581). We thank Dr. Aleksandra Deczkowska for assisting with the scRNA-seq analysis.
Authors’ contribution
Hengdong Qu performed the experiments, analyzed the data, and drafted the manuscript; Di Zhang and Junli Liu performed the experiments and analyzed the data; Jieping Deng and Chen Qu performed the bioinformatic analysis; Ruoyan Xie, Keke Zhang, Hongmei Li, and Ping Tao performed the experiments; Genshu Wang, Jian Su, Oscar Junhong Luo, and Chen Qu revised the manuscript; and Wencai Ye and Jian Hong designed and supervised the study.
Compliance with ethics guidelines
Hengdong Qu, Di Zhang, Junli Liu, Jieping Deng, Ruoyan Xie, Keke Zhang, Hongmei Li, Ping Tao, Genshu Wang, Jian Sun, Oscar Junhong Luo, Chen Qu, Wencai Ye, and Jian Hong declare that they have no conflict of interest or financial conflicts to disclose.