1. Introduction
Cardiac hypertrophy is an adaptive change in the function of the heart that supplies oxygen and nutrients to the body, enabling myocytes to maintain continuous contraction in response to various pathological stimuli and environmental changes [
1]. Pathological cardiac hypertrophy, driven by chronic stress, is characterized by both structural and functional alterations in the heart and is considered an independent risk factor for the onset of heart failure (HF) [
2]. Pathological hypertrophy results from abnormal increases in the levels of neurohumoral mediators, changes in blood flow, or visceral stress and injury [
3]. Consequently, improving our understanding of the underlying pathophysiological mechanisms of cardiac hypertrophy and identifying novel therapeutic targets are critical priorities in cardiovascular research.
Emerging evidence indicates that lysosomal communication and interactions with other organelles play crucial roles in determining the cardiomyocyte fate in HF [
4]. As terminal "degradation stations," lysosomes are pivotal for cellular material renewal, energy metabolism, and various cell death processes. Notably, lysosomes are integral to the clearance of damaged mitochondria and the maintenance of mitochondrial energy metabolism. Transient receptor potential mucolipin 1 (TRPML1) is a transient receptor potential (TRP) ion channel protein that is primarily localized in lysosomes. This calcium (Ca
2+) channel, comprising 580 amino acids and six transmembrane domains, is specifically expressed within endo/lysosomal compartments, where it regulates key lysosomal functions, such as biosynthesis, localization, phagocytosis, and degradation [
5]. TRPML1 plays pivotal roles in lysosomal biogenesis, exocytosis, and spatial organization. Studies in
Caenorhabditis elegans, Drosophila melanogaster, and
Mus musculus have revealed that mutations in TRPML1 disrupt lysosomal maturation [
6]. Feng et al. [
7] showed that the activation of TRPML1 ameliorates endothelial dysfunction by increasing lysosomal biogenesis and mitophagy. This protective mechanism is mediated by the activation of transcription factor EB (TFEB), which attenuates the palmitic acid (PA)-induced mitochondrial impairment and suppresses the increase in reactive oxygen species (ROS) production in endothelial cells. Additionally, TRPML1 activation confers neuroprotection against seizure-induced neuronal injury by ameliorating the pathological sequelae of epileptic seizures, including intracellular ROS accumulation, mitochondrial impairment, and neuronal apoptosis [
8]. These findings indicate that TRPML1 activation halts disease progression by restoring the function of damaged mitochondria. However, the mechanisms underlying the initiation of lysosomal clearance of damaged mitochondria in pathological cardiac hypertrophy remain unclear.
Voltage-dependent anion channel 1 (VDAC1) is a gated ion channel protein located on the outer mitochondrial membrane (OMM) [
9]. It functions as a mitochondrial gatekeeper, regulating mitochondrial energy metabolism, Ca
2+ ion influx, and the maintenance of mitochondrial Ca
2+ homeostasis [
10,
11]. Under apoptotic conditions, VDAC1 undergoes conformational changes, promoting its oligomerization into higher-order structures [
12-
14]. VDAC1 is critical for maintaining mitochondrial Ca
2+ homeostasis, enabling the precise regulation of mitochondrial energy metabolism and dynamics. Notably, transmembrane BAX inhibitor motif-containing 6 (TMBIM6), which is located on the endoplasmic reticulum (ER), has been shown to inhibit infectious cardiomyopathy by binding to VDAC1, reducing its oligomerization, and modulating mitochondrial Ca
2+ homeostasis [
15]. During cardiac hypertrophy, VDAC1 expression is upregulated, and VDAC1 interacts with the small heat-shock protein α-crystallin B (CRYAB) to mediate apoptotic pathways [
16]. The regulation of mitochondrial homeostasis also depends on interorganelle communication, with the ER and Golgi apparatus playing active roles in mitochondrial function during disease processes. In summary, VDAC1 plays a key role in maintaining mitochondrial homeostasis via a triad of mechanisms: regulating the mitochondrial membrane potential (MMP), undergoing dynamic shifts in its oligomerization state, and engaging in interorganellar communication. However, the mechanism by which VDAC1 participates in lysosomal TRPML1-mediated regulation of mitochondrial homeostasis to alleviate cardiac hypertrophy remains unclear.
In this study, we identified lysosomal TRPML1 as a critical regulator of mitochondrial homeostasis and cardiac function through its interaction with VDAC1 to suppress VDAC1 oligomerization following pathological cardiac hypertrophy. These findings reveal a novel mechanism by which mitochondrial Ca2+ dynamics are regulated via lysosomal TRPML1 channels, offering new therapeutic strategies for the treatment of cardiac hypertrophy.
2. Materials and methods
2.1. Experimental animals
Neonatal C57BL/6J mice were obtained from the Laboratory Animal Center of the Second Hospital of Harbin Medical University, China. Male C57BL/6J mice (8-10 weeks old, weighing 20-22 g) were purchased from Liaoning Changsheng Biotechnology Co., Ltd. (China). Additionally, TRPML1 gene knock-in mice on the C57BL/6J genetic background were acquired from Cyagen Biosciences (Suzhou), Inc. (China), while sex-matched wild-type (WT) littermates served as control subjects. All animal experimental protocols were approved by the Ethics Committee of Harbin Medical University (IRB3006822) and complied with the Guide for the care and use of laboratory animals from National Institutes of Health (NIH).
2.2. Construction of TRPML1 transgenic mice
The control TRPML1 knock-in (TRPML1fl/fl) mice were generated by Cyagen Biosciences (Suzhou), Inc. Briefly, a guide RNA (gRNA) targeting the mouse TRPML1 gene, a donor vector containing the "CAG promoter-loxP-PGK-Neo-6*SV40 pA-loxP-Kozak-Mouse TRPML1 CDS-rBG pA" cassette, and caspase 9 (Cas9) messenger RNA (mRNA) were coinjected into fertilized mouse zygotes to produce targeted conditional knock-in offspring. F0 founder animals were identified by polymerase chain reaction (PCR) and sequence analysis and subsequently bred with WT mice to confirm germline transmission and produce F1 offspring. Conditional TRPML1 knock-in mice were then crossed with myh6-Cre mice. After several generations of breeding, cardiomyocyte-specific TRPML1 knock-in (TRPML1 cKI) mice were successfully generated. Genotyping for TRPML1 knock-in was performed by PCR, and the sequences of the mouse primers are listed in Table S1 in Appendix A.
The control TRPML1 knockout (TRPML1fl/fl) mice were generated by Cyagen Biosciences (Suzhou), Inc. Briefly, the second exon of the TRPML1 gene was flanked by loxP sites. Two single guide RNAs (sgRNA1 and sgRNA2) were designed to target exon 2 of TRPML1. A donor vector containing exon 2 flanked by loxP sites, along with two homology arms, was used as a template for homologous recombination. Conditional TRPML1 knockout mice were then crossed with myh6-Cre mice. After several generations of breeding, cardiomyocyte-specific TRPML1 knockout (TRPML1 cKO) mice were successfully generated. Genotyping was performed by PCR, and the sequences of the mouse primers are listed in Table S2 in Appendix A.
2.3. Mouse transverse aortic constriction (TAC)-induced cardiac hypertrophy
The C57BL/6J mice used for the experiments were eight-week-old healthy male mice that were free from any illness or infection history. Male mice were selected because they respond strongly to cardiac pressure overload in terms of the development of cardiac hypertrophy and HF [
17]. The mice were randomly assigned to the sham-operated or TAC groups and anesthetized with avertin (0.2 g∙kg
-1; T48402; Sigma, USA). They were mechanically ventilated (UGO Basile S.R.L. Biological Research Apparatus, Italy). In the TAC group, a blunt incision was made in the second intercostal space, and a 6-0 polypropylene suture was tied around the aortic arch using a 27-gauge needle as a guide and then removed. The muscle and skin were sutured with 6-0 sutures. Sham mice underwent the same surgery but without aortic coarctation. Cardiac function was assessed by echocardiography eight weeks later. Blinding was implemented throughout the study to minimize bias.
2.4. Echocardiography
Echocardiography was performed using a Vevo 2100 system (VisualSonics, Canada) with a 10 MHz phased-array transducer using previously described protocols [
18]. Briefly, mice were anesthetized with avertin and placed on an operating table at 37 °C, maintaining a heart rate of 500 beats per minute or higher. M-mode recordings were used to measure the ejection fraction (EF%), fractional shortening of the short axis (FS%), and left ventricular internal dimensions at end-diastole (LVIDd) and systole (LVIDs). For the TAC group, only mice with a maximum flow velocity of approximately 3000 mm∙s
-1 on the ligature were included in the analysis.
2.5. Histological analysis
Following anesthesia, mouse hearts were harvested and fixed with 4% paraformaldehyde (BL539A; Biosharp, China) for 48 h. The heart tissue was then processed using conventional paraffin (39601095; Leica, Germany) embedding techniques, and gradient dehydration was performed. The tissue sections were cut at a thickness of 5 μm and stained with hematoxylin and eosin (H&E; G1120; Solarbio, China) for histopathological analysis and Masson’s trichrome (G1340; Solarbio) for collagen quantification according to the manufacturer’s instructions. Myocyte cross-sectional area (CSA) were quantified using wheat germ agglutinin (WGA; L4895; Sigma) staining according to the manufacturer’s protocol. All images were analyzed using Image-Pro Plus 3.0 (Media Cybernetics, USA).
2.6. Isolation of adult mouse cardiomyocytes
Adult cardiomyocytes were isolated from C57BL/6J mice aged 8-12 weeks. Briefly, the mice were anesthetized, and the chest was opened to expose the heart. The descending aorta was excised, and 7 mL of ethylenediamine tetraacetic acid (EDTA) buffer (C0167; Beyotime, China) was injected into the right ventricle. The ascending aorta was clamped, and the heart was then immersed in a 60 mm petri dish containing EDTA buffer. The heart was digested by sequential injections of 10 mL of EDTA buffer, 3 mL of perfusion buffer (ZK-L0513; Shenzhen Ziker Biological Technology Co., Ltd., China), and 30-50 mL of collagenase buffer (17078-029; Gibco, USA) into the left ventricle. After digestion, the cardiomyocytes were filtered, subjected to four rounds of gravity settling, and stored at -80 °C for further experiments.
2.7. Cell culture
Neonatal mouse cardiomyocytes (NMCMs) were isolated from 1-3-day-old C57BL/6J mice as previously described [
19]. A brief description of the procedure is provided below. After the heart was removed, it was washed, minced in 0.25% trypsin (SC109-01; SEVEN BIOTECH, China), and incubated overnight at 4 °C. The cells were subsequently digested with collagenase type II (BS164; Biosharp) and suspended in Dulbecco’s modified Eagle medium (DMEM; D6429; Sigma) supplemented with 10% fetal bovine serum (FBS; C04001; Vivacell, China) and 1% penicillin‒streptomycin (SC118-01; SEVEN BIOTECH). After centrifugation, the cells were inoculated into culture flasks and incubated for 1 h. The nonadherent cells were collected and incubated for 48 h at 37 °C in a 5% CO
2 incubator. NMCMs were then treated with angiotensin II (Ang II; HY-13948; MCE, USA; 1 μmol∙L
-1, 24 h), synthetic mucolipin agonist 1 (ML-SA1; HY-108462; MCE; 20 μmol∙L
-1, 24 h), synthetic mucolipin inhibitor 3 (ML-SI3; E0026; Selleck, USA; 20 μmol∙L
-1, 24 h), or 1,3-bis(4-aminophenyl)urea (NSC 15364; S0231; Selleck; 20 μmol∙L
-1, 24 h). The HEK 293T cell line was purchased from the Cell Bank of the Chinese Academy of Sciences (China) and cultured in DMEM supplemented with 10% FBS and 1% penicillin‒streptomycin.
2.8. MitoTracker staining
Lyophilized MitoTracker (M7512; Thermo Fisher Scientific, USA) was dissolved in high-quality anhydrous dimethyl sulfoxide (DMSO; HY-Y0320C; MCE) to a final concentration of 1 mmol∙L-1 as the stock solution. For live cell staining, a working concentration of 100 nmol∙L-1 was used, whereas for cells requiring fixation and permeabilization, a working concentration of 200 nmol∙L-1 was used. Once the desired degree of mitochondrial fusion was achieved, the medium was replaced with a prewarmed (37 °C) staining solution containing the MitoTracker probe. The cells were incubated at 37 °C in the dark for 30 min. After staining, the cells were washed with fresh DMEM and imaged using a confocal laser scanning microscope (FV300; Olympus, Japan).
2.9. MitoSOX staining
Lyophilized MitoSOX (M36008; Invitrogen, USA) was dissolved in high-quality anhydrous DMSO to a final concentration of 5 mmol∙L-1 as the stock solution. For live cell staining, a working concentration of 5 μmol∙L-1 was used. The cells were incubated with the staining solution at 37 °C in the dark for 10 min. After staining, the cells were washed with fresh DMEM and imaged using a confocal laser scanning microscope.
2.10. ROS staining
Total cellular ROS levels were measured using the 2′,7′-dichlorofluorescein diacetate (DCFH-DA) probe (S0033S; Beyotime). After the desired degree of cell fusion was achieved, the DCFH-DA probe (10 μmol∙L-1) was added to serum-free DMEM and incubated with the cells at 37 °C in the dark for 30 min. The treated cardiomyocytes were then imaged using a confocal laser scanning microscope.
2.11. Measurement of the MMP
The MMP was assessed with a Mitochondrial Membrane Potential Test Kit (JC-1; C2006; Beyotime). The JC-1 probe was added to serum-free DMEM and incubated with the cells (37 °C, in the dark, 20 min). The treated cardiomyocytes were analyzed using a confocal laser scanning microscope.
2.12. Detection of mitochondrial respiratory function
Mitochondrial respiration was assessed in cardiomyocytes using a high-resolution respirometry system (Oxygraph-2k; Oroboros Instruments, Austria) with the sequential titration of oligomycin (Omy; HY-N6782; MCE), the uncoupler carbonyl cyanide
m-chlorophenylhydrazone (FCCP; HY-100410; MCE), rotenone (Rot; HY-B1756; MCE), and antimycin A (Ama; HY-N12257; MCE), as described in our previous study [
20]. The oxygen consumption rate (OCR) recorded after treatment with 1 μmol∙L
-1 oligomycin was subtracted from the basal OCR measured before treatment to quantify mitochondrial ATP production [
21].
2.13. Coimmunoprecipitation (Co-IP) and molecular docking assays
The cells were lysed using ice-precooled lysis buffer consisting of 50 mmol∙L-1 Tris (pH 7.4), 150 mmol∙L-1 NaCl, 1% nonidet P-40 (NP-40), sodium pyrophosphate, β-glycerophosphate, sodium orthovanadate, sodium fluoride, 2 mmol∙L-1 EDTA (P0013F; Beyotime) and a protease inhibitor cocktail (78438; Thermo Fisher Scientific). A total of 1000 μg of protein per sample was subjected to immunoprecipitation using Protein A/G magnetic beads (HY-K0202; MCE) preconjugated with antibodies, including anti-Flag Tag, anti-hemagglutinin (HA) Tag, anti-TRPML1, anti-VDAC1/Porin + VDAC3 and the normal mouse immunoglobulin G (IgG) as a control (Table S3 in Appendix A). The beads were subsequently washed three times to remove nonspecifically bound proteins, and proteins bound to the beads were eluted by boiling in loading buffer (P0015; Beyotime) for subsequent analysis via Western blotting.
The molecular docking analysis was performed using the Schrödinger 2017-1 suite (Schrödinger Inc., USA). The TRPML1 and VDAC1 protein structures were obtained from crystal structure databases and prepared for docking using the Protein Preparation Wizard workflow within the Maestro package.
2.14. In situ Duolink proximity ligation assay (PLA)
The PLA was performed using the NaveniFlex™ Cell Red kit (NC.MR.100 Red; Navinci, Sweden) according to the manufacturer’s instructions. Briefly, NMCMs were fixed, permeabilized, and blocked. The cells were subsequently incubated overnight at 4 °C with primary antibodies against TRPML1 and VDAC1 derived from different species. After the samples were washed with buffer, the secondary antibodies included in the kit were added, and the samples were incubated at 37 °C for 60 min. When Navenibodies are in close proximity, the attached oligonucleotides form a DNA circle. Upon the addition of polymerase, rolling circle amplification (RCA) was initiated. Fluorescently labeled probes then bound to the amplified DNA products, generating detectable spot signals. Finally, the nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; C1005; Beyotime), and images were acquired using a confocal microscope (FluoView FV10i; Olympus).
2.15. Protein extraction and Western blotting
The procedures used for protein extraction and Western blotting were performed as described previously [
22]. Briefly, cells or heart tissues were washed with ice-cold phosphate-buffered saline (PBS; SC106-01; SEVEN BIOTECH) and lysed in radio immunoprecipitation assay (RIPA) buffer (P0013B; Beyotime) supplemented with a protease inhibitor cocktail (78438; Thermo Fisher Scientific). The protein concentration of each sample was quantified using a bicinchoninic acid (BCA) protein assay kit (P0009; Beyotime). A total of 90 μg of protein per sample was loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS‒PAGE) gels, separated, and then transferred to nitrocellulose membranes (66485; PALL, USA). The membranes were blocked with 5% nonfat milk (SW128; SEVEN BIOTECH) at room temperature for 2 h and subsequently incubated overnight at 4 °C with primary antibodies (Table S3).
2.16. Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted using TRIzol reagent (15596018CN; Invitrogen). Reverse transcription reactions were performed using ReverTra Ace® qPCR RT Master Mix (FSQ-201; Toyobo, Japan). qRT-PCR was performed using Universal SYBR Green Master Mix (491391400; Roche, Switzerland). Gene expression levels were normalized using the 2-ΔΔCT method. The sequences of the primers used for qRT-PCR analysis are listed in Table S4 in Appendix A.
2.17. Immunofluorescence (IF) staining
NMCMs and adult mouse cardiomyocytes were fixed with 4% paraformaldehyde for 30 min. Permeabilization was performed using 0.3% Triton X-100 (ST795; Beyotime) for 15 min, followed by blocking with goat serum (C0265; Beyotime) for 1 h at room temperature. The cells were then incubated overnight at 4 °C with primary antibodies targeting TRPML1 and α-actinin. After the incubation with the primary antibody, the cells were incubated with secondary antibodies (Alexa Fluor® 488-labeled goat anti-mouse IgG H&L; ab150113; Abcam, UK; or Alexa Fluor® 488-labeled goat anti-rabbit IgG H&L; ab150080; Abcam) for 1 h at room temperature. The nuclei were counterstained with DAPI for 15 min. IF signals were observed and captured using a confocal laser scanning microscope.
2.18. Transmission electron microscopy (TEM)
Heart tissues were trimmed into small pieces (< 1 mm3) and fixed with glutaraldehyde (16537; Electron Microscopy Sciences, USA) to preserve the ultrastructure. After fixation, the samples were treated with 1% citric acid for 2 h at 4 °C, followed by staining with 2% uranium acetate, dehydration with gradient ethanol solutions (50%, 70%, 90%, and 100%), and infiltration with 100% acetone for 2 h. Pure Epon 812 resin (14120; Electron Microscopy Sciences) was used for embedding and polymerized overnight at 30 °C. Ultrathin sections were prepared and collected on Formvar-coated copper mesh (FCF100-Cu-UA; Electron Microscopy Sciences), stained with uranium acetate and lead citrate, and then analyzed using a JEM-1200 electron microscope (JEOL Ltd., Japan).
2.19. Transfection procedures
Primary cardiomyocytes and HEK 293T cells (TCH-C190; Cos9x®, China) were first starved in serum-free DMEM for 4-6 h to improve the transfection efficiency.
For primary cardiomyocyte transfection (functional studies), 50 nmol∙L-1 small interfering RNA (siRNA; si-NC/si-TRPML1; synthesized by GenePharma Co., Ltd., China) was mixed with 5 μL of Lipofectamine™ 2000 (11668019; Invitrogen) in 250 μL of serum-free DMEM. For the plasmid transfections, we mixed 2 µg of plasmid (pcDNA3.1-Vector/pcDNA3.1-TRPML1, synthesized by GENE CREATE Co., Ltd., China) with 5 μL of Lipofectamine™ 2000 in 250 μL of serum-free DMEM. Afterward, we added the complexes in a dropwise manner and incubated them with the cells for 6 h (37 °C, 5% CO2). After 6 h, the medium was changed to fresh DMEM containing 10% FBS, followed by further incubation for 48 h under standard conditions before subsequent analysis.
For the cell cotransfection of HEK 293T cells (protein interaction), we mixed 2 μg of total plasmid (pcDNA3.1-HA-TRPML1 FL/pcDNA3.1-HA-TRPML1 ΔTM/pcDNA3.1-HA-TRPML1 ΔN/pcDNA3.1-HA-TRPML1 ΔC and pcDNA3.1-Flag-VDAC1/pcDNA3.1-Flag-VDAC1 ΔN, synthesized by GENE CREATE Co., Ltd.) with 5 μL of Lipofectamine™ 2000 in 250 μL of serum-free DMEM. Afterward, we added the complexes in a dropwise manner and incubated them with the cells for 6 h (37 °C, 5% CO2). After 6 h, the medium was changed to fresh DMEM containing 10% FBS, followed by further incubation for 48 h under standard conditions before subsequent analysis.
For primary cardiomyocyte transfection (sequential cotransfection), we first mixed 50 nmol∙L-1 siRNA (si-NC/si-Statb, synthesized by GenePharma Co., Ltd.) with 5 μL of Lipofectamine™ 2000 in 250 μL of serum-free DMEM. Afterward, we added the complexes in a dropwise manner and incubated them with the cells for 6 h (37 °C, 5% CO2). After 6 h, the medium was changed to fresh DMEM supplemented with 10% FBS, followed by a further incubation for 24 h. After 24 h, we mixed 2 µg of plasmid (pcDNA3.1-TRPML1, synthesized by GENE CREATE Co., Ltd.) with 5 μL of Lipofectamine™ 2000 in 250 μL of serum-free DMEM. Afterward, we added the complexes in a dropwise manner and incubated them with the cells for 6 h (37 °C, 5% CO2). After 6 h, the medium was changed to fresh DMEM containing 10% FBS, followed by further incubation for 48 h under standard conditions before subsequent analysis.
2.20. Measurement of mitochondrial Ca2+ levels
Mitochondrial Ca2+ in NMCMs was labeled with Lv-CMV-Mito-Gcamp6f-WPRE (Brain VTA Co., Ltd., China). NMCMs were seeded in 48-well plates at a density of 1.2 × 107 cells per well in 250 µL of complete medium. After 48 h of incubation to allow cell attachment, the complete medium was replaced with DMEM. Infection was conducted at a multiplicity of infection (MOI; calculated as the ratio of infectious units to the number of cells) of 100 for 6 h, after which the medium was replaced with complete medium. The cells were then grouped and treated with the corresponding pharmacological agents according to the experimental design. Following an additional 48 h of culture, imaging was performed using a Zeiss Axio Observer microscope to assess mitochondrial Ca2+ levels.
2.21. Four-dimensional (4D)-fast data independent acquisition (DIA) mass spectrometry (MS)
The MS analysis using 4D-fast DIA was performed by PTM Bio (China) with a standardized workflow. Peptides were separated by gradient elution: The concentration of solvent B increased from 9% to 24% in the first 8 min, then from 24% to 35% in 4 min, from 35% to 80% at 12-16 min, and was maintained at 80% at 16-20 min. Chromatographic separations were performed on a NanoElute UHPLC system (Bruker Daltonics, Inc., USA) at a flow rate of 450 nL∙min-1. The separated peptides were analyzed using a timsTOF Pro mass spectrometer equipped with a capillary ion source. The DIA data were collected and used for peptide and protein identification by the DIA-NN search engine (version 1.8).
2.22. Dual-luciferase reporter assay
Luciferase reporter plasmids were generated by cloning the WT or mutant (MT) TRPML1 promoter sequences into the pGL3-basic vector (GENE CREATE Co., Ltd.). HEK 293T cells were transiently cotransfected with 2 μg of the firefly luciferase reporter plasmid (pGL3-WT/MT TRPML1; GENE CREATE Co., Ltd.), 2 μg of signal transducer and activator of transcription 5B (Stat5b) expression plasmid (or pcDNA3.1 empty vector control; GENE CREATE Co., Ltd.), and 2 μg of Renilla luciferase internal control plasmid (pRL-TK; GENE CREATE Co., Ltd.) using Lipofectamine™ 2000 in accordance with the manufacturer’s protocol. Cells were harvested at 48 h post-transfection, and luciferase activity was quantified using the Dual-Luciferase® Reporter Assay System (E1910; Promega, USA). Firefly luciferase signals were normalized to Renilla luciferase activity for each sample.
2.23. Chromatin immunoprecipitation (ChIP)-qPCR assay
ChIP assays were performed using a SimpleChIP® Plus Enzymatic Chromatin IP Kit (#9005; Cell Signaling Technology, USA) according to the manufacturer’s instructions. Briefly, the NMCMs were cross-linked with 1% formaldehyde for 10 min at room temperature, and the reaction was quenched by the addition of 0.125 mol∙L-1 glycine to prevent excessive crosslinking. After two washes with ice-cold PBS, the cells were collected by centrifugation, and the supernatant was discarded. The cell pellet was resuspended in ChIP lysis buffer supplemented with protease inhibitors and subjected to sonication to shear DNA into fragments ranging from 200 to 1000 bp. The specific antibody against Stat5b and a nonspecific rabbit IgG antibody were added and incubated with the samples overnight at 4 °C, followed by an incubation with Protein A/G magnetic beads for 120 min to capture the antibody-protein-DNA complexes. The samples were placed on a magnetic stand to remove the supernatant and were subsequently washed three times with different wash buffers (low-salt and high-salt buffers). The cross-links were reversed by an incubation with decrosslinking buffer at room temperature for 30 min, followed by treatment with RNase A and proteinase K at 37 °C for 1 h. Finally, the DNA was purified using spin columns. The purified DNA was analyzed using qPCR to verify the binding sites of the target protein. The TRPML1 sequences are as follows: F, ATACGGTTCTATTTGGTTTAGG and R, GCTTCACCTGTTACCCTCA.
2.24. VDAC1 crosslinking assay
The cells were incubated with 200 μmol∙L-1 ethylene glycol bis(succinimidyl succinate) (EGS; HY-130458; MCE) at 30 °C for 15 min to induce VDAC1 crosslinking. The samples were then sonicated twice for 10 s each to ensure thorough lysis. After sonication, the samples were mixed with loading buffer and boiled at 100 °C for 10 min. The prepared samples were subjected to SDS‒PAGE, followed by immunoblotting with an anti-VDAC1 antibody for detection.
2.25. Statistical analysis
The data are presented as the means ± standard errors of the means (SEMs). Statistical analyses were conducted using Prism 8.0 software (GraphPad Software, USA). Student’s t test was used to compare the data from two groups. Comparisons between multiple groups were performed using one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison post hoc test. Differences between groups were separated into two independent factors using two-way ANOVA followed by Tukey’s post hoc test. Statistical significance was considered when the P value < 0.05. The significance level is indicated as follows: *P < 0.05, **P < 0.01, and ***P < 0.001.
3. Results
3.1. TRPML1 expression is reduced in individuals with cardiac hypertrophy
Pathological cardiac hypertrophy is a pivotal process that drives the development of HF [
23]. We screened a single-cell database of a mouse HF model (GSE255054) to identify a novel regulator of pathological cardiac hypertrophy [
24]. The cell types were divided into seven clusters using Seurat, and we extracted cardiomyocyte subsets and compared the HF cardiomyocytes with control cardiomyocytes to analyze characteristic genes (
Fig. 1(a), Fig. S1 in Appendix A). An imbalance in mitochondrial homeostasis serves as a critical driver of the pathological progression of cardiac hypertrophy to HF [
25,
26]. Therefore, we screened genes related to mitochondrial homeostasis using the GeneCards database and intersected them with the differentially expressed genes in cardiomyocyte subsets to identify key regulators of mitochondrial homeostasis during the progression from cardiac hypertrophy to HF. A total of 51 overlapping genes were identified (Fig. S2 in Appendix A). A protein‒protein interaction (PPI) network was subsequently constructed using the STRING database, and we observed that TRPML1 is involved in the regulation of mitochondrial homeostasis (
Fig. 1(b)). To clarify the expression profile of
TRPML1 in the heart, we initially employed bulk RNA sequencing (RNA-seq) to examine the expression of
TRPML1 in both healthy individuals and patients with HF. The results revealed the significant downregulation of
TRPML1 expression in HF patients (Fig. S3 in Appendix A). Furthermore, we scanned RNA-seq data for human heart samples from the GSE255054, GSE21610, GSE76701, and GSE59867 datasets. We found that
TRPML1 expression decreased coincidently during HF (
Figs. 1(c)-
(f)).
We collected mouse heart lysates eight weeks after TAC surgery to further explore the expression of TRPML1 in a murine pathological cardiac hypertrophy model. Western blot and qRT-PCR analyses revealed that the protein and mRNA levels of the cardiac hypertrophy marker β-myosin heavy chain (β-MHC) were significantly increased following TAC surgery. In contrast, the TRPML1 protein and mRNA levels were markedly decreased (
Figs. 1(g) and
(h)). Furthermore, IF staining showed a reduction in TRPML1 expression in cardiomyocytes from adult mice subjected to TAC compared with cardiomyocytes from the sham-operated group (
Fig. 1(i)). NMCMs were isolated from 1-3-day-old C57BL/6J mice and analyzed in a cardiac hypertrophy model induced by Ang II stimulation to extend these findings. Western blot and qRT-PCR analyses revealed the significant upregulation of β-MHC and atrial natriuretic peptide (ANP) protein and mRNA levels in Ang II-stimulated cells, whereas TRPML1 protein and mRNA levels were notably reduced (
Figs. 1(j) and
(k)). These findings suggest that reduced TRPML1 expression may be a common feature of cardiac hypertrophy, highlighting the need for further investigation into the role of TRPML1 in cardiovascular diseases.
3.2. TRPML1 protects against pressure overload-induced cardiac hypertrophy
We generated cardiomyocyte-specific
TRPML1 cKI mice to investigate the function of TRPML1 in cardiac hypertrophy (
Fig. 2(a)), and Western blot analysis confirmed that TRPML1 was successfully overexpressed in the hearts of mice (
Fig. 2(b)). In addition, assessment of TRPML1 protein levels in the heart, liver, lung, and kidney of
TRPML1 cKI mice via Western blot assays demonstrated that the overexpression of TRPML1 was restricted only to the heart tissue (
Fig. 2(c)).
Baseline cardiac function was evaluated in
TRPML1 cKI mice via echocardiography, which showed no significant differences in EF%, FS%, LVIDd, and LVIDs compared with those in
TRPML1fl/fl mice. However, eight weeks after TAC-induced pressure overload,
TRPML1 cKI mice exhibited significantly improved cardiac function, with higher EF% and FS% than
TRPML1fl/fl mice. Additionally, the TAC-induced increases in LVIDd and LVIDs observed in
TRPML1fl/fl mice were attenuated in
TRPML1 cKI mice (
Fig. 2(d)). Morphological analyses showed that
TRPML1 cKI mice exhibited a reduced heart volume (
Fig. 2(e)) and lower heart weight normalized to body weight (HW/BW) and tibial length (HW/TL) ratios (
Fig. 2(f)) than
TRPML1fl/fl mice following TAC. Histological staining, including WGA and Masson’s trichrome staining, revealed that the cardiomyocyte CSA and degree of interstitial fibrosis were significantly reduced in
TRPML1 cKI mice compared with
TRPML1fl/fl mice following TAC (
Fig. 2(g)). TEM revealed that TAC-induced mitochondrial damage, including sparse and disorganized cristae, empty vacuoles, broken membranes, and reduced mitochondrial volume, was significantly mitigated in
TRPML1 cKI mice compared with
TRPML1fl/fl mice (
Fig. 2(h)). Additionally, Western blot analysis revealed lower expression levels of the β-MHC protein in
TRPML1 cKI mice (
Fig. 2(i)), along with corresponding decreases in
β-MHC,
ANP, and brain natriuretic peptide
(BNP) mRNA expression levels following TAC (
Fig. 2(j)).
Mitochondrial homeostasis, including balanced fusion and fission, is critical for maintaining mitochondrial integrity and function, thereby preventing myocardial injury. Western blot analysis showed that the mitochondrial fusion proteins mitofusin 2 (Mfn2) and optic atrophy 1 (OPA1) were upregulated in
TRPML1 cKI mice after TAC (Figs. S4(a)-(c) in Appendix A). Conversely, the phosphorylation at Ser616 of dynamin-related protein 1 (p-Drp1
Ser616), which promotes mitochondrial fission, decreased, whereas its phosphorylation at Ser637 (p-Drp1
Ser637), which inhibits mitochondrial fission [
27], increased in
TRPML1 cKI mice after TAC (Figs. S4(d) and (e) in Appendix A).
Collectively, these findings indicate that the cardiomyocyte-specific overexpression of TRPML1 attenuates TAC-induced myocardial structural abnormalities and improves mitochondrial function. These cardioprotective effects suggest that TRPML1 is a promising therapeutic target for preventing the progression of pathological cardiac hypertrophy.
3.3. TRPML1 deficiency promotes the progression of pressure overload-induced cardiac hypertrophy
We generated
TRPML1 cKO mice by crossing myh6-Cre mice with
TRPML1fl/fl mice to further investigate the role of TRPML1
in vivo (
Fig. 3(a)). Western blot analysis confirmed that TRPML1 was successfully knockout in the hearts of mice (
Fig. 3(b)). Furthermore, assessment of TRPML1 protein levels in the heart, liver, lung, and kidney of
TRPML1 cKO mice via Western blot assays demonstrated that the knockout of TRPML1 was restricted only to the heart tissue (
Fig. 3(c)).
The baseline echocardiographic analysis revealed no significant differences in EF%, FS%, LVIDd, or LVIDs between
TRPML1 cKO and
TRPML1fl/fl mice. However, eight weeks after TAC surgery to induce cardiac hypertrophy, EF% and FS% were significantly lower in
TRPML1 cKO mice than in
TRPML1fl/fl mice. Additionally, LVIDd and LVIDs were significantly higher in
TRPML1 cKO mice after TAC (
Fig. 3(d)).
The morphometric analysis revealed that the heart volume (
Fig. 3(e)) and the HW/BW and HW/TL ratios (
Fig. 3(f)) were markedly increased in
TRPML1 cKO mice compared with
TRPML1fl/fl mice under pressure overload conditions. Histological analyses, including WGA and Masson’s trichrome staining, showed that
TRPML1 cKO mice exhibited further increases in the CSA and collagen deposition after TAC (
Fig. 3(g)). TEM revealed that the cardiomyocyte-specific knockout of
TRPML1 exacerbated mitochondrial abnormalities, including increased numbers of empty vacuoles, broken membranes, reduced mitochondrial volume, and disorganized cristae structures, after TAC (
Fig. 3(h)). Western blot analysis revealed that
TRPML1 cKO mice displayed elevated expression levels of the β-MHC protein (
Fig. 3(i)), along with corresponding increases in
β-MHC,
ANP, and
BNP mRNA expression levels after TAC surgery (
Fig. 3(j)). The expression of mitochondrial fusion proteins, including Mfn2 and OPA1, was further reduced in
TRPML1 cKO mice after TAC-induced cardiac hypertrophy (Figs. S5(a)-(c) in Appendix A). Additionally, compared with
TRPML1fl/fl mice, TAC induced the reduction of p-Drp1
Ser637 and increase of p-Drp
Ser616 in
TRPML1 cKO mice (Figs. S5(d) and (e) in Appendix A). In conclusion, the cardiomyocyte-specific knockout of
TRPML1 results in cardiac dysfunction, exacerbates mitochondrial abnormalities, and promotes the progression of pathological cardiac hypertrophy under pathological pressure overload conditions.
3.4. TRPML1 attenuates Ang II-induced cardiomyocyte hypertrophy in vitro
In vitro, we used ML-SA1 (20 μmol∙L
-1, 24 h), a TRPML1-specific agonist that induces lysosomal Ca
2+ release by binding to the aromatic pocket of the TRPML1 subunit [
28-
34], to explore the effect of TRPML1 activation on Ang II-induced cardiomyocyte hypertrophy. β-MHC and ANP expression were elevated in hypertrophic cardiomyocytes. However, this hypertrophic effect was reversed upon treatment with ML-SA1, which specifically activated TRPML1 (Figs. S6(a) and (b) in Appendix A). Similarly, the
β-MHC and
ANP mRNA expression levels were significantly reduced when TRPML1 was activated by ML-SA1 in Ang II-induced hypertrophic cardiomyocytes (Fig. S6(c) in Appendix A). Additionally, the CSA, as detected by α-actinin staining, was decreased following ML-SA1 stimulation compared with Ang II stimulation alone (Fig. S6(d) in Appendix A).
Next, we overexpressed TRPML1 using the pcDNA3.1 vector (Fig. S7(a) in Appendix A). Consistent with previous findings, TRPML1 overexpression significantly reduced β-MHC and ANP protein expression in cardiomyocytes with Ang II-induced hypertrophy (Figs. S7(b) and (c) in Appendix A). Moreover, the β-MHC and ANP mRNA expression levels were decreased by TRPML1 overexpression in cardiomyocytes with Ang II-induced hypertrophy (Fig. S7(d) in Appendix A). Immunostaining confirmed that TRPML1 overexpression reduced the CSA following Ang II stimulation (Fig. S7(e) in Appendix A).
ML- SI3, a specific inhibitor of TRPML channels, effectively suppresses TRPML1 activity. We treated cardiomyocytes with ML-SI3 (20 μmol∙L
-1) for 24 h to explore the role of TRPML1 in Ang II-induced hypertrophy [
33,
35]. Western blot analysis revealed that the expression of the hypertrophic markers β-MHC and ANP increased upon treatment with ML-SI3 following Ang II stimulation (Figs. S8(a) and (b) in Appendix A). Similarly, the mRNA levels of
β-MHC and
ANP were increased by ML-SI3 treatment in Ang II-induced hypertrophic cardiomyocytes (Fig. S8(c) in Appendix A). Unlike ML-SA1, which attenuated hypertrophy, ML-SI3 resulted in an increase in the CSA after Ang II stimulation (Fig. S8(d) in Appendix A).
We further investigated the role of TRPML1 by knocking it down in NMCMs using an siRNA targeting TRPML1. Western blot analysis confirmed the successful knockdown of TRPML1 (Fig. S9(a) in Appendix A). As expected, TRPML1 knockdown significantly increased β-MHC and ANP protein expression in Ang II-treated hypertrophic cardiomyocytes (Figs. S9(b) and (c) in Appendix A). The qRT-PCR analysis also revealed further increases in the mRNA levels of β-MHC and ANP following TRPML1 knockdown in Ang II-treated hypertrophic cardiomyocytes (Fig. S9(d) in Appendix A). Additionally, the CSA was increased by TRPML1 knockdown following Ang II stimulation (Fig. S9(e) in Appendix A).
Taken together, these results suggest that TRPML1 plays a pivotal role in modulating cardiomyocyte hypertrophy. However, the precise molecular mechanisms underlying this effect remain to be elucidated in future studies.
3.5. TRPML1 interacts with VDAC1
Mitochondrial and lysosomal functions are closely interconnected and essential for maintaining cellular homeostasis [
36]. We investigated the mechanism by which TRPML1 regulates cardiomyocyte hypertrophy using 4D-Fast DIA MS to identify potential target proteins that interact with TRPML1 in NMCMs. Notably, we identified 263 proteins that interact with TRPML1, with a significant proportion enriched in mitochondrial proteins. Among these interactions, we discovered that TRPML1 binds to VDAC1, a marker protein localized to the OMM (
Fig. 4(a)). Moreover, molecular docking simulations further demonstrated that TRPML1 interacts with VDAC1 (
Fig. 4(b)). Co-IP assays further confirmed that TRPML1 interacted with VDAC1 under physiological conditions, but this interaction was significantly reduced following TAC surgery (
Fig. 4(c)). In addition, we confirmed that TRPML1 interacted with VDAC1 in untreated NMCMs; however, in Ang II-induced hypertrophic NMCMs, this interaction was disrupted (
Fig. 4(d)). A PLA further revealed the interaction between TRPML1 and VDAC1 in untreated NMCMs, while Ang II suppressed this interaction (Fig. S10(a) in Appendix A). This study conclusively confirms that TRPML1 directly interacts with VDAC1, and this interaction is significantly impaired under pathological hypertrophy conditions.
3.6. TRPML1 binding to VDAC1 via its C-terminal domain mediates VDAC1 oligomerization
VDAC1 oligomerizes in response to apoptotic stimuli and various stressors, allowing excessive Ca
2+ influx into the mitochondria. This process results in mitochondrial Ca
2+ overload, disrupting energy metabolism and mitochondrial homeostasis [
9]. We employed EGS crosslinking to examine VDAC1 oligomerization and investigate the specific mechanism by which the TRPML1-VDAC1 axis regulates mitochondrial function in hypertrophic NMCMs. As expected, Ang II stimulation significantly increased the degree of VDAC1 oligomerization. Ang II primarily exerts its effects by binding to the AT1 receptor (AT1R), activating multiple downstream signaling pathways that lead to an increased intracellular Ca
2+ concentration and the development of hypertrophy [
37-
39]. We further investigated the mechanism underlying VDAC1 oligomerization in Ang II-induced hypertrophic cardiomyocytes by inhibiting AT1R using losartan (1 μmol∙L
-1, 24 h) [
40] and performed EGS crosslinking assays to assess VDAC1 oligomerization. Notably, compared with Ang II treatment, losartan treatment significantly reduced VDAC1 oligomerization (Figs. S10(b) and (c) in Appendix A). These results suggest that Ang II may promote VDAC1 oligomerization by altering cardiomyocyte homeostasis through AT1R activation. Furthermore, the TRPML1 agonist ML-SA1 or overexpression of TRPML1 reversed the increase in VDAC1 oligomerization in Ang II-induced hypertrophic cardiomyocytes (
Fig. 5(a), Figs. S10(d)-(f) in Appendix A). In contrast, the inhibition of TRPML1 using the TRPML1-specific inhibitor ML-SI3 or knockdown of
TRPML1 further exacerbated VDAC1 oligomerization in Ang II-induced hypertrophic cardiomyocytes (
Fig. 5(b), Fig. S11(a) in Appendix A). We generated a panel of
TRPML1 deletion mutants in which distinct functional domains were targeted to explore the molecular mechanism underlying the TRPML1-mediated inhibition of VDAC1 oligomerization. Systematic mapping of the binding domains through IP assays unequivocally indicated that the C-terminal domain of TRPML1 was crucial for binding to VDAC1 (
Fig. 5(c)). We then transfected NMCMs with either full-length (FL)
TRPML1 or its various functional domain deletion variants. The crosslinking analysis demonstrated that the oligomerization of VDAC1 was markedly inhibited by FL
TRPML1 and two of its truncation mutants (ΔTM, ΔN), but not by the C-terminal deletion mutant (ΔC) (
Fig. 5(d), Fig. S11(b) in Appendix A). Previous studies have identified the N-terminal region of VDAC1 as its functional domain [
41]. The N-terminus of VDAC1 plays a pivotal role in mediating its oligomerization [
10,
42]. We generated a VDAC1 N-terminal deletion mutant (ΔN) and performed IP assays to determine whether TRPML1 binds to the N-terminus of VDAC1. Our data indicated that TRPML1 specifically interacts with the N-terminus of VDAC1 (
Fig. 5(e)). In summary, our study revealed that the C-terminus of TRPML1 directly binds to the VDAC1 N-terminal domain to regulate its oligomerization and facilitate communication between these organelles and may play a role in the maintenance of normal cellular physiological functions in Ang II-induced hypertrophic cardiomyocytes.
3.7. TRPML1 regulates mitochondrial homeostasis in hypertrophic cardiomyocytes
Cardiac hypertrophy is frequently associated with impaired Ca
2+ handling, which results in mitochondrial dysfunction and a subsequent decrease in the energy supply to hypertrophic cardiomyocytes, ultimately contributing to HF [
43]. We investigated whether TRPML1 can regulate mitochondrial Ca
2+ ([Ca
2+]
m) overload, thereby affecting mitochondrial homeostasis in hypertrophic cardiomyocytes, using Lv-CMV-Mito-Gcamp6f-WPRE to detect [Ca
2+]
m. As shown in
Fig. 6(a), ML-SA1 treatment effectively inhibited the [Ca
2+]
m overload induced by Ang II stimulation. Furthermore, lysosome-mitochondria contacts might be modulated by the lysosomal regulator Ras-related protein Rab7 (RAB7) GTPase1 [
44], which in turn allows lysosomes to regulate [Ca
2+]
m levels [
45]. Therefore, we confirmed that the TRPML1-VDAC1 interaction mechanistically affects mitochondrial [Ca
2+]
m overload by administering the RAB7 GTPase inhibitor 2-(3-benzoylthioureido)-5,5-dimethyl-5,7-dihydro-4H-thieno[2,3- c]pyran-3-carboxylic acid (ML282; 40 μmol∙L
-1) [
46] to specifically disrupt this interaction. The IF colocalization analysis revealed strong colocalization of TRPML1 with mitochondria under basal conditions. However, this colocalization was lost upon ML282 stimulation (
Fig. 6(b)). Co-IP assays also confirmed that TRPML1 interacts with VDAC1 under physiological conditions, but this interaction was significantly disrupted following ML282 stimulation in NMCMs (
Fig. 6(c)). We then used Lv-CMV-Mito-Gcamp6f-WPRE to assess [Ca
2+]
m levels after disrupting lysosome-mitochondria contacts with ML282. Compared with the results presented in
Fig. 6(a), ML282 treatment counteracted the effect of TRPML1 activation on attenuating [Ca
2+]
m overload in Ang II-induced hypertrophic cardiomyocytes (
Fig. 6(d)).
We assessed total ROS production using a DCFH-DA assay to determine whether TRPML1 activation regulates mitochondrial homeostasis by reducing [Ca
2+]
m overload in Ang II-induced hypertrophic cardiomyocytes, and the results indicated that ROS production was significantly lower in the ML-SA1-treated group than in the Ang II-stimulated group (
Fig. 6(e)). Additionally, mitochondrial ROS (mROS) levels were measured using MitoSOX staining (
Fig. 6(f)). After 24 h of Ang II exposure, mROS production was increased, but ML-SA1 treatment reduced the mROS levels. Next, we measured the MMP using JC-1 staining. The MMP was significantly lower in Ang II-stimulated cardiomyocytes than in control cardiomyocytes (
Fig. 6(g)). However, treatment with the TRPML1 agonist ML-SA1 reversed these changes. Furthermore, ML-SA1 treatment attenuated Ang II-induced changes in the mitochondrial morphology and abnormal distribution, reducing the number of mitochondrial fission events in NMCMs (
Fig. 6(h)).
Additionally, ML-SA1 treatment increased the expression of the mitochondrial fusion proteins Mfn2 and OPA1 in Ang II-induced hypertrophic cardiomyocytes. After 24 h of Ang II exposure, the Drp1
Ser616 increased, while the Drp1
Ser637 decreased. ML-SA1 treatment reversed these changes (
Fig. 6(i)). Mitochondrial oxidative phosphorylation (OXPHOS) is a primary source of energy in the heart; thus, we measured the mitochondrial OCR in cardiomyocytes. As shown in
Fig. 6(j), ML-SA1 treatment reversed the reductions in basal respiration, ATP production, and maximal respiration induced by Ang II.
In contrast, the TRPML1 inhibitor ML-SI3 exacerbated the Ang II-induced increases in ROS production (Fig. S12(a) in Appendix A) and mROS levels (Fig. S12(b) in Appendix A). The MMP was significantly lower in ML-SI3-treated cardiomyocytes than in Ang II-treated cardiomyocytes (Fig. S12(c) in Appendix A). MitoTracker staining revealed that ML-SI3 promoted mitochondrial fragmentation and increased the proportion of mitochondrial fission events compared with Ang II (Fig. S13(a) in Appendix A). Additionally, the expression of the mitochondrial fusion proteins Mfn2 and OPA1 was further reduced, while p-Drp1Ser616 levels were increased, and p-Drp1Ser637 levels were decreased in the ML-SI3-treated group (Figs. S13(b)- (f) in Appendix A). Furthermore, ML-SI3 treatment aggravated the Ang II-induced reductions in basal respiration, ATP production, and maximal respiration, as measured by the mitochondrial OCR (Figs. S14(a)-(d) in Appendix A).
In conclusion, these findings suggest that TRPML1 plays a crucial role in maintaining mitochondrial homeostasis and energy production by regulating [Ca2+]m overload in hypertrophic cardiomyocytes. TRPML1 is essential for preserving normal cardiomyocyte function and mitigating the effects of pathological stress.
3.8. TRPML1 mitigates mitochondrial damage and cardiac hypertrophy by repressing VDAC1 oligomerization
As previously noted, VDAC1 oligomerization in response to factors such as apoptosis or stress results in excessive cytosolic Ca
2+ entry into mitochondria, leading to mitochondrial dysfunction. We treated cardiomyocytes with NSC 15364 (20 μmol∙L
-1 for 24 h), a well-established inhibitor of VDAC1 oligomerization and apoptosis that effectively suppresses VDAC1 oligomerization [
47-
49], to further investigate whether TRPML1 regulates mitochondrial homeostasis by inhibiting VDAC1 oligomerization. As shown in
Fig. 7(a) and Fig. S14(e) in Appendix A, NSC 15364 treatment significantly reduced VDAC1 oligomerization in Ang II-stimulated cardiomyocytes. Although ML-SI3 treatment reduced the expression of the mitochondrial fusion proteins Mfn2 and OPA1 in hypertrophic cardiomyocytes, the VDAC1 inhibitor NSC 15364 reversed this reduction (
Fig. 7(b)). Moreover, the inhibition of VDAC1 oligomerization mitigated the increase in mitochondrial fission, as evidenced by reduced levels of p-Drp1
Ser616 (which promotes fission) and increased levels of p-Drp1
Ser637 (which inhibits fission) (
Fig. 7(b)). Additionally, total ROS and mROS production were lower in the NSC 15364-treated group than in the ML-SI3 group (
Figs. 7(c) and
(d)). The MMP, measured by JC-1 staining, was significantly reduced in ML-SI3-treated cardiomyocytes compared with Ang II-treated cardiomyocytes. However, NSC 15364 treatment restored the MMP in hypertrophic cardiomyocytes (
Fig. 7(e)). Furthermore, MitoTracker staining revealed that ML-SI3 treatment increased mitochondrial fragmentation and fission events in Ang II-induced hypertrophic cardiomyocytes. This increase in mitochondrial fission was alleviated by NSC 15364 treatment (
Fig. 7(f)). These findings suggest that inhibiting VDAC1 oligomerization can alleviate mitochondrial dysfunction in hypertrophic cardiomyocytes.
We explored whether inhibition of VDAC1 oligomerization could reverse cardiac hypertrophy by measuring the expression of hypertrophic markers in Ang II-treated cells. Fig. S15(a) in Appendix A show that β-MHC protein expression was significantly reduced by NSC 15364 treatment in hypertrophic cardiomyocytes compared with ML-SI3 treatment. Similarly, the mRNA expression levels of the hypertrophic markers β-MHC, ANP, and BNP were significantly reduced by NSC 15364 compared with ML-SI3 (Fig. S15(b) in Appendix A). IF staining revealed that NSC 15364 treatment decreased the CSA of ML-SI3-stimulated hypertrophic cardiomyocytes (Fig. S15(c) in Appendix A).
Taken together, these results suggest that inhibiting VDAC1 oligomerization not only alleviates mitochondrial dysfunction but also attenuates cardiac hypertrophy induced by Ang II and ML-SI3 treatments in cardiomyocytes.
3.9. The reduction of VDAC1 oligomerization rescues TAC-induced cardiac hypertrophy in TRPML1 cKO mice
We previously showed that the inhibition of VDAC1 oligomerization reduces cardiomyocyte hypertrophy by restoring mitochondrial function in Ang II-treated NMCMs. The present study was designed to assess whether reducing VDAC1 oligomerization could reverse TAC-induced pathological cardiac hypertrophy in
TRPML1 cKO mice. We inhibited VDAC1 oligomerization by administering NSC 15364 (2.5 mg∙kg
-1, in a vehicle of 10% DMSO + 40% polyethylene glycol (PEG) 300 + 5% Tween-80 + 45% saline) via intraperitoneal injection twice weekly over an eight-week period following TAC-induced cardiac hypertrophy (
Fig. 8(a)).
As anticipated, NSC 15364 treatment significantly improved cardiac function in both
TRPML1fl/fl and
TRPML1 cKO TAC mice, as evidenced by increased EF% and FS% and reduced LVIDd and LVIDs (
Fig. 8(b)). Furthermore, NSC 15364 treatment prevented the TAC-induced increase in heart volume (
Fig. 8(c)), and the increase in HW/BW and HW/TL ratios in
TRPML1 cKO mice (
Fig. 8(d)).
The histological analysis revealed that TAC-induced cardiac hypertrophy, which is characterized by increased CSA and interstitial fibrosis in
TRPML1 cKO mice, was significantly attenuated by NSC 15364 treatment (
Fig. 8(e)). In addition, the upregulation of the expression of hypertrophic markers, including the β-MHC protein and mRNA, as well as
ANP and
BNP mRNA expression, in
TRPML1 cKO mice was effectively reversed by the inhibition of VDAC1 oligomerization (
Figs. 8(f) and
(g)).
These data suggest that the inhibitory effects of TRPML1 on cardiac hypertrophy are at least partially mediated by the inhibition of VDAC1 oligomerization, which highlights a potential therapeutic strategy for mitigating the progression of pathological cardiac hypertrophy.
3.10. Signal transducer and activator of transcription 5B (Stat5b) is a transcriptional regulator of TRPML1
We screened transcription factors using the University of California, Santa Cruz (UCSC), ChIP-X Enrichment Analysis 3 (CHEA3), and Animal Transcription Factor Database version 4.0 (AnimalTFDB4) databases to identify the transcriptional regulators of TRPML1. Our analysis revealed 85 transcription factors capable of binding to TRPML1, which were identified through the intersections of these three databases (
Fig. 9(a)). Further investigation using the JASPAR database indicated a potential binding site for
Stat5b in the
TRPML1 promoter region, specifically between nucleotides 1698 and 1712 (
Fig. 9(b)).
The Stat5 family consists of two members: Stat5a and Stat5b. Notably, Stat5b is predominantly expressed in the heart and has been implicated in cardiac injury and HF [
50-
52]. Previous studies have shown that the inhibition of Stat5 significantly worsens pressure overload-induced cardiac hypertrophy by suppressing the activation of phosphoinositide 3-kinase (PI3K)/Akt signaling [
53]. These findings led us to investigate whether Stat5b affects cardiac hypertrophy through the regulation of
TRPML1 transcription. We tested our hypothesis by constructing luciferase vectors containing WT or MT sequences of the
TRPML1 promoter and then transfecting them into HEK293T cells. The results revealed that Stat5b activated the WT
TRPML1 promoter, as evidenced by the increased luciferase activity, whereas this effect was absent in cells transfected with the MT
TRPML1 promoter construct (
Fig. 9(c)). We next performed a ChIP‒qPCR assay to determine whether
Stat5b can directly bind to the
TRPML1 promoter. Notably, the
TRPML1 promoter region was strikingly enriched in the Stat5b precipitate from NMCMs under physiological conditions (
Fig. 9(d)). Subsequent experiments revealed that both Stat5b protein and mRNA expression were significantly reduced following TAC surgery (
Fig. 9(e)). Furthermore,
Stat5b knockdown led to a marked decrease in TRPML1 protein levels (
Fig. 9(f)).
We elucidated the functional relationship between Stat5b and TRPML1 in cardiac hypertrophy by knocking down
Stat5b in cells through the transfection of si-
Stat5b. This intervention significantly amplified hypertrophic responses, as evidenced by increased β-MHC protein levels and mRNA expression of
β-MHC,
ANP, and
BNP (
Figs. 9(g) and
(h)). Moreover, we found that TRPML1 protein and mRNA expression further decreased after Ang II-stimulated hypertrophic cardiomyocytes were transfected with si-
Stat5b (
Figs. 9(g) and
(h)). Interestingly, in Ang II-induced hypertrophic cardiomyocytes, TRPML1 overexpression still significantly attenuated the expression of hypertrophy markers, including the β-MHC protein and
β-MHC,
ANP, and
BNP mRNAs, even under Stat5b-depleted conditions after 24 h of siRNA pretreatment (
Figs. 9(g) and
(h)). Furthermore, α-actinin IF staining showed that
Stat5b knockdown exacerbated the Ang II-induced increase in the CSA of cardiomyocytes. Notably, TRPML1 overexpression effectively attenuated cardiac hypertrophy even when it was introduced 24 h after Stat5b depletion (
Fig. 9(i)).
In conclusion, while Stat5b transcriptionally regulates TRPML1 under physiological conditions, TRPML1 can activate compensatory cardioprotective pathways in the absence of Stat5b.
4. Discussion
This study delineates the critical cardioprotective role of TRPML1, revealing its molecular mechanism in the suppression of cardiac hypertrophy through the inhibition of VDAC1 oligomerization, thereby attenuating mitochondrial Ca2+ overload and associated damage.
Lysosomes orchestrate proteostasis, metabolic regulation, and cell death pathways through dynamic interorganellar communication [
4]. Mitochondria—particularly those that are vital in cardiomyocytes, where they constitute ∼75% of the cellular organelles—maintain cardiac contractility by sustaining energy homeostasis. Their morphology and abundance are dynamically regulated through fission/fusion cycles to meet the exceptional bioenergetic demands of cardiomyocytes [
54].
In humans, rats, and mice, three
VDAC genes (
VDAC1,
VDAC2, and
VDAC3) encoding distinct isoforms of the VDAC protein have been identified [
55]. Among these genes,
VDAC1 is the most widely expressed gene, whose expression is high in the heart, kidney, brain, and skeletal muscle [
56]. VDAC1 is among the most abundant proteins in the OMM and acts as a gatekeeper that regulates the exchange of metabolites and ions between the mitochondria and the cytoplasm, thereby mediating the energetic and metabolic crosstalk essential for cellular function.
Recent studies have shown that mitochondria are damaged by inhibitors of carnitine palmitoyl transferase 1A and that VDAC1 plays a protective role by regulating the uptake of long-chain fatty acids (LCFAs) into mitochondria during HF [
57]. VDAC1 also facilitates the transport of other essential molecules across the OMM, including Ca
2+, cholesterol, fatty acids, and ROS. Through its regulation of Ca
2+ flux, VDAC1 maintains mitochondrial Ca
2+ homeostasis and plays a critical role in OXPHOS. It also mediates Ca
2+ crosstalk between the OMM and inositol 1,4,5-trisphosphate (IP
3) receptors in the ER [
58,
59].
During apoptosis, VDAC1 oligomerizes to form large pores that facilitate the release of apoptotic factors, such as cytochrome c, which contribute to cell death. These pores are believed to be formed by homo-oligomers of VDAC1 or hetero-oligomers involving VDAC1 and apoptotic proteins from the Bcl-2 family [
60,
61]. Recent studies have shown that the activation of the NOD-like receptor family pyrin domain-containing protein 3 (NLRP3) inflammasome induces unidirectional transporter-mediated Ca
2+ uptake, leading to the opening of the mitochondrial permeability transition pore and subsequent VDAC oligomerization. This process results in the release of mitochondrial DNA (mtDNA) and activates the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway, triggering a potent inflammatory response [
62]. Furthermore, the dissociation of hexokinase 2 from VDAC1 activates IP
3 receptors, leading to the release of Ca
2+ from the ER. This influx of Ca
2+ into the mitochondria promotes further VDAC1 oligomerization, amplifying the inflammatory response [
63]. Despite these emerging insights, the mechanistic contribution of VDAC1 oligomerization to cardiovascular pathologies, particularly cardiac hypertrophy, remains elusive. Our study revealed that VDAC1 oligomerization is a driver of mitochondrial Ca
2+ overload in Ang II-induced hypertrophic cardiomyocytes. This oligomerization-dependent Ca
2+ dysregulation underlies the pathological cytosolic Ca
2+ accumulation observed in Ang II-stimulated cardiomyocytes.
Collectively, our results establish VDAC1 oligomerization as a previously unrecognized driver of pathological cardiac remodeling and reveal that targeting VDAC1 represents a mechanism-directed strategy for treating hypertrophy.
Intercommunication between organelles has garnered increasing attention in recent years. Tight interorgan connections are essential for maintaining normal cellular physiology. The Golgi apparatus regulates endosome division through budding vesicles, highlighting the highly cooperative interactions between different membrane-bound organelle systems within the cell [
64]. Moreover, the ER protein TMBIM6 has been shown to confer cardioprotective effects on lipopolysaccharide (LPS)-induced sepsis by binding to and suppressing the oligomerization of VDAC1, a key pathway for mitochondrial Ca
2+ uptake [
15]. These findings underscore the protective role of ER-mitochondrion intercommunication in the myocardium, suggesting a novel therapeutic strategy for treating sepsis-induced cardiac injury.
Both the mitochondria and lysosomes are crucial for maintaining intracellular homeostasis, and their interactions contribute to normal cellular functions. Researchers have confirmed that mitochondria‒lysosome contacts are dynamically formed in healthy, untreated cells, while damaged mitochondria are targeted for lysosomal degradation. Fission 1 (FIS1) recruits the RAB7 GTPase-activating protein TBC1 domain family member 15 (TBC1D15) to the mitochondria, where it induces the hydrolysis of RAB7 GTP, leading to the release of the contact site [
65]. This study introduces the novel concept that lysosomal contacts mark sites of mitochondrial fission, enabling lysosomes to regulate the mitochondrial network. Conversely, mitochondrial contacts modulate lysosomal RAB7 hydrolysis via TBC1D15. Furthermore, Peng et al. [
45] reported that the TRPML1-specific agonist ML-SA1 facilitates the formation of mitochondrial-lysosome contacts across diverse cellular contexts, including fibroblasts and HCT116 cells. These observations establish a mechanistic basis whereby TRPML1 activation suppresses VDAC1 oligomerization through enhanced organellar tethering.
In conclusion, we confirm that lysosomal TRPML1, a channel protein located on the lysosomal membrane, plays a pivotal role in regulating mitochondrial homeostasis and dynamics. TRPML1 promotes mitochondrial homeostasis by directly binding to VDAC1 on the OMM and inhibiting its oligomerization. Our findings provide novel insights into mitochondria‒lysosome intercommunication, offering new therapeutic avenues for treating pathological cardiac hypertrophy.
Previous investigations of TRPML1 have focused on its regulation of lysosomal autophagy and exocytosis. While our study demonstrated that the inhibition of TRPML1 ameliorates pathological cardiac remodeling in individuals with hypertrophy, the role of TRPML1 is complex and may vary significantly across different pathological contexts. For instance, in myocardial ischemia/reperfusion (I/R) injury, TRPML1 activation contributes to impaired autophagic flux and cardiomyocyte death, suggesting that its inhibition could be beneficial in that context [
35]. Conversely, TRPML1 activation can suppress seizure-induced neuronal damage by attenuating intracellular ROS production, restoring mitochondrial function, and alleviating neuronal apoptosis [
8]. These apparent discrepancies highlight the cell type- and disease-specific nature of TRPML1 signaling. The differential outcomes could stem from the interplay between TRPML1 activity and distinct downstream pathways operating in various cellular environments, the severity and stage of the disease, and the timing and concentration of pharmacological interventions. Future studies comparing TRPML1 function across these different models will be crucial to fully elucidate its pleiotropic role and translate these findings into targeted therapeutic strategies.
However, our study has several limitations. First, the absence of kinetic data limits our understanding of how TRPML1 affects lysosomal movement toward mitochondria. Future studies are warranted to determine whether increased TRPML1 channel activity directly drives lysosomal repositioning to mitochondria. Although the pharmacological inhibition of VDAC1 oligomerization rescues TRPML1 loss-of-function phenotypes, we cannot exclude the potential off-target effects of NSC 15364, nor can we assert that VDAC1 oligomerization is the sole downstream effector. TRPML1 may signal through additional unidentified pathways, which merit further investigation. Additionally, in the present study, we focused on using male mice to minimize variability introduced by the well-documented hormonal fluctuations of the estrous cycle in females, thereby allowing us to more clearly delineate the pathological mechanisms underlying TAC. However, the undeniable importance of sex as a biological variable requires further investigation. Subsequent research will focus on comparing the responses of males and females to TAC to explore potential sex-specific pathways and the therapeutic implications. Finally, the lack of human samples restricts a direct extrapolation of the role of TRPML1 in human HF. Subsequent studies will focus on characterizing TRPML1 expression in human HF specimens to better define its therapeutic relevance.
5. Conclusions
Collectively, our findings establish that TRPML1 acts as a guardian of cardiac function through the preservation of mitochondrial homeostasis via the suppression of VDAC1 oligomerization. Abnormal expression of TRPML1 may represent a common pathway in myocardial injury and cardiac hypertrophy, and TRPML1 may serve as a potential target for the diagnosis and treatment of HF induced by pathological cardiac hypertrophy in clinical practice.
PDF
(14320KB)
