1. Introduction
Wheat powdery mildew caused by the fungal pathogen
Blumeria graminis f. sp.
tritici (
Bgt), is a destructive disease that diminishes both yield and grain quality by impairing photosynthesis, increasing lodging, and hindering grain development. Its prevalence has intensified with modern agronomic practices, particularly those involving high nitrogen fertilization and intensive irrigation, which favor pathogen proliferation [
1]. While fungicides can provide short-term protection, the incorporation of powdery mildew resistance genes into breeding programs offers a more sustainable and environmentally friendly approach to disease management.
Over 100 powdery mildew resistance genes and alleles have been identified to date [
2], [
3]. Several, including
Pm2,
Pm4,
Pm6,
Pm8, and
Pm21, have been extensively utilized in wheat breeding programs [
4], [
5], [
6]. However, only 26 powdery mildew resistance genes have been cloned. Among these, those originating from common wheat (
Triticum aestivum) include
Pm1a [
7],
Pm3b [
8],
Pm5e [
9],
Pm24 [
10],
Pm38/
Lr34/
Yr18/
Sr57 [
11], and
Pm46/
Lr67/
Yr46/
Sr55 [
12]. Genes introgressed from closely related species include
Pm2 and
WTK4 (
Aegilops tauschii) [
13], [
14],
Pm12 (
Ae. speltoides) [
15], and
Pm60 (
T. urartu) [
16]. Tetraploid wheat contributes several cloned genes, such as
Pm4 [
17],
Pm6/
Pm52 [
18], [
19],
Pm36 [
20],
Pm41 [
21],
Pm68 [
22], [
23], [
24], and
Pm69 [
25]. Additional genes identified in
Aegilops species include
Pm13 [
26], [
27] and
Pm6Sl [
28] from
Ae. longissima,
Pm57 [
29] from
Ae. searsii, and
PmAeu1 [
30] from
Ae. umbellulata. Other cloned
Pm resistance genes from more distant wild relatives include
Pm8 [
31],
Pm17 [
32], and
PmTR1/
PmTR3 [
33] from rye (
Secale cereale) as well as
Pm21 [
34], [
35] and
Pm55 [
36] from
Dasypyrum villosum. Despite these advances, the widespread adoption of powdery mildew resistance genes in breeding remains constrained by linkage drag associated with wild donors and the rapid evolution of virulent
Bgt isolates [
5], [
37]. This emphasizes the need to identify novel resistance sources with minimal agronomic trade-offs.
Conventional map-based cloning is a reliable approach, but often encounters difficulties in resolving genes located within recombination-suppressed regions, such as pericentric intervals or introgressed segments derived from wild relatives. The development of advanced sequencing technologies has accelerated gene discovery through rapid mutant-sequencing strategies, including mutagenesis and resistance gene enrichment sequencing (MutRenSeq) [
38], mutant chromosome sequencing (MutChromSeq) [
13], sequencing trait-associated mutations (STAM) [
39], and mutagenesis and isoform sequencing (MutIsoSeq) [
40]. These methods have successfully enabled the cloning of resistance genes in
Triticeae [
7], [
41], [
42], [
43], [
44], [
45], [
46]. Complementing these approaches, exon capture sequencing provides high target specificity and uniformity, facilitating efficient genotyping and the cloning of functional genes [
47], [
48].
In this study, we identified and functionally characterized
PmNCA6, a powdery mildew resistance gene derived from wild wheat
T. boeoticum [
49]. We applied mutant exome sequencing (MutExomeSeq), a strategy that allows the detection of causal mutations even in genomic regions with suppressed recombination. The function of
PmNCA6 was confirmed through virus-induced gene silencing (VIGS) and transgenic complementation, and its breeding potential was evaluated using near-isogenic lines (NILs) and recombinant inbred lines (RILs). This study establishes MutExomeSeq as a robust tool for cloning genes in recombination-suppressed regions, offering a general solution for gene isolation in complex genomes. Furthermore, this work provides a valuable genetic resource for enhancing resistance against rapidly evolving powdery mildew pathogens.
2. Materials and methods
2.1. Plant materials
The common wheat line NC96BGTA6 (PI 599036), obtained from the US National Plant Germplasm System (NPGS), carries the powdery mildew resistance gene
PmNCA6, introgressed from
T. boeoticum accession PI 427772 [
50]. The advanced breeding line YangYF267, derived from a cross between NC96BGTA6 and Yangmai 15, exhibits resistance to powdery mildew. For genetic mapping, an F
2 population (> 2000 plants) was generated by crossing YangYF267 with the high-yielding, susceptible line Yang09DPBZ. A 244-line F
2:8 RIL population from this cross was used to evaluate the effects of
PmNCA6 on agronomic traits. The NIL Yang20M105 was developed through four backcrosses of Yang09DPBZ (recurrent parent) to YangYF267 (donor). The susceptible cultivar Fielder was transformed for functional validation. Additionally,
PmNCA6 distribution was examined in an array of 553 commercial cultivars (Table S1 in Appendix A), and allelic variation was assessed in 24
T. boeoticum accessions (Table S2 in Appendix A)
.2.2. Evaluation of powdery mildew response
Plants were cultivated in a controlled-environment chamber under a 16-h photoperiod at 22 °C during the day and 15 °C at night, with 70% relative humidity. Inoculation was performed using the
Bgt isolate BgtYZ01, collected from Yangzhou, Jiangsu Province, China, by brushing fresh conidiospores onto the leaves. At least two independent experiments, each including a minimum of five plants per line, were conducted. Disease symptoms were evaluated 7-10 days post-inoculation (dpi), when the susceptible parent Yang09DPBZ exhibited severe infection. Plants were classified as resistant (R; no or minimal sporulation) or susceptible (S; extensive leaf sporulation). The resistance spectrum of YangYF267 was further assessed against 18
Bgt isolates (Table S3 in Appendix A) using a standardized 0-4 infection type (IT) scale [
51], where IT scores of 0-2 represent resistance and 3-4 indicate susceptibility. These evaluations were conducted at the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. Additionally, 22
Bgt isolates were employed to evaluate the resistance of
PmNCA6 transgenic plants and
pmnca6 EMS-induced mutants (Table S4 in Appendix A).
2.3. Bulked segregant exome capture sequencing (BSE-Seq) analysis
An F
2 population was inoculated with the
Bgt isolate BgtYZ01. A total of 400 susceptible and 200 resistant plants were selected for DNA extraction. Equal amounts of DNA from resistant and susceptible plants were pooled to generate two respective bulks, which, along with the parental lines (YangYF267 and Yang09DPBZ), were sequenced using the GenoBaits® Wheat Exome Panel (Catalog No. PHR0106_TaWES; Molbreeding Biotechnology Co., Ltd., China). This panel targets 304 328 exonic regions, covering > 97% of high-confidence protein-coding genes in the Chinese Spring reference genome. Raw sequencing data were quality-filtered with fastp (v0.20.0; parameters: -n 10 -q 20 -u 40) [
52] to remove adapters and low-quality reads. Clean reads were aligned to the reference genome using Burrows-Wheeler aligner maximal exact matches (BWA-MEM) [
53]. Variant calling was carried out with GATK (v3.5-0-g36282e4; parameters: -dcov 1000000 -minIndelFrac 0.15 -glm BOTH -l INFO) [
54], followed by filtration using GATK VariantFiltration (parameters: --filterExpression “MQ0 >= 4 && ((MQ0 / (1.0 * DP)) > 0.1) ” --filterName “HARD_TO_VALIDATE” --filterExpression “DP < 5 || QD < 2” --filterName “LOW_READ_SUPPORT”).
Single nucleotide polymorphisms (SNPs) were genotyped as 1 (when identical to the resistant parent YangYF267) and 0 (when identical to the susceptible parent Yang09DPBZ). The SNP-index was calculated for each bulk, and the Δ(SNP-index) was obtained as the difference between the SNP-indices of the R-bulk and S-bulk. Candidate genomic regions were identified using a 2-Mb sliding window with 100-kb steps, applying a 99% confidence threshold based on 1000 permutations [
55].
To delineate the
T. boeoticum introgression on chromosome 7A, the exome sequencing data from YangYF267 were aligned to both the Chinese Spring reference genome (RefSeq v2.1) and the
T. boeoticum reference genomes using the BWA-MEM v0.7.17 [
53], [
56], [
57]. The resulting alignments were sorted and indexed with SAMtools v1.15 [
58]. Genome-wide coverage was calculated using BEDTools v2.30.0 by partitioning the reference genome into 1-Mb non-overlapping windows using bedtools makewindows and computing read counts per window using bedtools coverage [
59]. Coverage statistics, including mean, median, and standard deviation, were calculated for each chromosome. Coverage distributions were visualized using two complementary approaches: ① chromosome ideograms with overlaid coverage heatmaps generated using RIdeogram v0.2.2 [
60], and ② detailed statistical plots including line plots, faceted comparisons, and bar charts created using ggplot2 v3.4.0 in R v4.2.0 [
61].
2.4. Development of molecular markers
InDel and SNP variants between the resistant parent (YangYF267) and the susceptible parent (Yang09DPBZ) were identified through exon capture sequencing. InDel loci (> 10 bp) were selected for primer design using Primer3, with target amplicon size ≤ 500 bp. Kompetitive allele-specific polymerase chain reaction (KASP) markers were designed using Polymarker, and primers were modified to incorporate standard 5' fluorescent tails (FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT). All primers were synthesized by Tsingke Biological Technology (China).
Within the 560-713 Mb target interval, 28 primer pairs (18 InDel, ten KASP) were designed and validated for polymorphisms between the two parents and their contrasting bulks. Markers that displayed consistent polymorphisms in both parental lines and bulks were considered linked to PmNCA6. Ultimately, 15 markers were confirmed to be linked to PmNCA6 (Table S5 in Appendix A).
2.5. Ethyl methanesulfonate (EMS) mutagenesis
To obtain powdery mildew-susceptible mutants, 5000 seeds of the resistant line YangYF267 were treated with 0.8% EMS. The treated seeds were grown in the field, and seeds from 1800 surviving M1 plants were individually harvested. From these, 800 M2 families were advanced for phenotypic screening. In the M2 generation, 20 seedlings per line were grown in a controlled-environment chamber along with resistant (YangYF267) and susceptible (Yang09DPBZ) controls. All plants were inoculated with BgtYZ01 at the seedling stage. Disease responses were assessed once Yang09DPBZ exhibited severe symptoms. Seedlings showing visible sporulation were classified as susceptible and subsequently genotyped using haplotype markers (7AID-621, 7AID-641, 7AID-667, 7AID-686, 7AID-694, and 7AID-713) located in the PmNCA6 region. Mutants retaining the YangYF267 haplotype were confirmed as EMS-induced susceptible lines.
2.6. MutExomeSeq analysis
Six independent EMS-induced susceptible mutants of YangYF267, along with the wild-type (WT) YangYF267, were subjected to exon capture sequencing. The resulting reads were aligned to the Chinese Spring reference genome (RefSeq v2.1) [
56]. Genes carrying sequence variation between YangYF267 and the reference were selected as potential
PmNCA6 candidates. Comparative analysis of coding sequences (CDS) revealed a nucleotide-binding leucine-rich repeat gene
NLR1 (
TraesCS7A03G1212700) that harbored non-synonymous mutations in all six mutants, confirming it as the candidate of
PmNCA6. The exome sequencing results were further validated through amplification and Sanger-sequencing of the NLR CDS region across all mutants.
2.7. Barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) analysis
To verify the function of NLR1, BSMV-VIGS was carried out in YangYF267. Two fragments corresponding to the nucleotide-binding sequence (NBS; 1303-1462 bp) and leucine-rich repeat (LRR; 1997-2166 bp) domains of NLR1 were cloned in reverse orientation into the pCa-γbLIC vector, generating the pCa-γb-NLR1 construct. Control constructs included BSMV:γ-PDS (targeting phytoene desaturase (PDS), to induce photobleaching) and BSMV:γ (empty vector). At 10 dpi, the fourth leaves were collected for quantitative reverse transcription PCR (qRT-PCR) to assess silencing efficiency. Systemic VIGS was confirmed by chlorophyll loss in PDS-silenced plants. For resistance assessment, leaves from ten plants per construct were cultured on a medium containing 6-benzylaminopurine (6-BA) and inoculated with Bgt.
2.8. Gene isolation
Total RNA was extracted from the first and second leaves of YangYF267 and 24
T. boeoticum accessions at 0, 8, 18, and 24 h post-inoculation (hpi) with the
Bgt isolate BgtYZ01. RNA extraction was performed using the VeZol-Pure Total RNA Isolation Kit (Vazyme, China; Catalog No. RC202-01), and first-strand complementary DNA (cDNA) synthesis was carried out with the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme; Catalog No. R312-01). Coding sequences of
NLR genes were amplified from the cDNA using the primer pair
P-exon-NLR and subsequently sequenced via Sanger sequencing. A 13 516-bp genomic fragment containing the native promoter and terminator regions of
NLR1 was amplified from
T. boeoticum accession PI 427772, the original donor of
PmNCA6 [
50], using the primer pair
P-Genomic-NLR. All PCR amplifications were conducted using the 2× Phanta Max Master Mix (Vazyme; Catalog No. P525-01).
2.9. Design and synthesis of chimeric genes
Sequence alignment between the NLR1 and Sr22a (EBI: LN883743) revealed a conserved region (1405-1743 bp) spanning the coiled-coil (CC)-NBS and LRR domains, which was defined as the recombination site. To investigate this region, two chimeric genes, NCG1 and NCG2, along with Sr22a, were synthesized (Tsingke Biological Technology, China). NCG1 contains the CC-NBS domains (amino acids (aa) 1-470) of Sr22a and the LRR domain (aa 471-940) of NLR1, whereas NCG2 fuses the CC and NBS domains (aa 1-470) of NLR1 with the LRR domain (aa 471-940) of Sr22a (see supplemental sequences in Appendix A).
2.10. Genetic transformation of wheat
Three NLR1 splice variants (NLR1_V1, NLR1_V2, and NLR1_V3) were cloned into the overexpression vector pLGY-OE3 under the control of the maize Ubiquitin promoter using BamHI and SacI restriction sites. A 13 516-bp genomic fragment encompassing NLR1 along with its native promoter and terminator was inserted into pLGY-OE3, replacing the Ubiquitin promoter. The chimeric genes (NCG1 and NCG2) and Sr22a were likewise cloned into pLGY-OE3 driven by the Ubiquitin promoter. All resulting constructs were introduced into the powdery mildew-susceptible wheat cultivar Fielder through Agrobacterium tumefaciens-mediated transformation.
2.11. Transgenic assays
The functions of the NLR1 splice variants (V1-V3), the native genomic NLR1 fragment, the chimeric genes (NCG1 and NCG2), and Sr22a were evaluated through transgenic complementation in the wheat cultivar Fielder. Transgenic T0 and T1 plants were initially screened for the presence of the transgene using the construct-specific primer pair P-GM-NLR for Ubiquitin promoter-driven constructs, while the diagnostic marker FM-NLR verified the integration of the native NLR1 genomic fragment. For each independent transgenic event, at least ten PCR-positive seedlings were inoculated with the powdery mildew isolate BgtYZ01. Disease responses were subsequently assessed, with non-transformed Fielder plants serving as susceptible controls.
2.12. Evolutionary analysis of PmNCA6 and related NLR proteins
To elucidate the evolutionary position of PmNCA6, a phylogenetic tree was constructed together with NLR-type resistance proteins from wheat, related species and T. boeoticum. Full-length protein sequences were retrieved from the NCBI and WheatOmics databases. Multiple sequence alignment was performed using ClustalW in MEGA7. The phylogenetic tree was reconstructed using the Neighbor-Joining method and Poisson correction model. Final visualization and annotation were carried out using the Interactive Tree of Life online tool. Synteny analysis of the PmNCA6 interval between the Chinese Spring genome and T. boeoticum was performed using the Triticeae-GeneTribe website.
2.13. Evaluation of agronomic performance and yield effects
During the 2021-2022 growing season, four key agronomic traits—plant height, spike length, spikelet number per spike, and grain number per spike—were assessed in YangYF267, Yang09DPBZ, and an RIL population. The experiment was conducted at the Yangzhou Experimental Farm with two replicates, sowing 40 seeds per row for each line. Fungicide was applied to control powdery mildew. In each replicate, fifty resistant and fifty susceptible RILs were randomly selected, and 20 plants per RIL were evaluated for main stem traits. Data were analyzed using analysis of variance (ANOVA) with multiple comparisons in SPSS (v20.0; IBM Corporation, USA).
To assess yield effects, the NILs Yang24M105 and Yang09DBPZ were grown in 3.3 m × 2.0 m plots during the 2022-2023 and 2023-2024 seasons, with three replicates at a density of 300 seedlings∙m−2 and fungicide protection. All plants in each plot were harvested, and the final yield was determined as the mean across replicates.
3. Results
3.1. PmNCA6 confers powdery mildew resistance in YangYF267
Wheat line YangYF267, which carries PmNCA6, exhibited high resistance to powdery mildew at both the seedling and adult-plant stages. Upon inoculation with Bgt isolate BgtYZ01, YangYF267 displayed no visible disease symptoms, whereas the susceptible control Yang09DPBZ developed extensive conidial sporulation (Fig. S1 in Appendix A). To evaluate the resistance spectrum, YangYF267 and 37 wheat lines harboring known powdery mildew resistance genes were tested with 18 distinct Bgt isolates, with YangYF267 demonstrating multi-isolate resistance (Table S3).
Genetic analysis of 15 F1 and 200 F2 progeny from a cross between YangYF267 and Yang09DPBZ indicated that resistance is controlled by a single dominant gene. All F1 plants and 158 F2 plants were resistant to the Bgt isolate BgtYZ01, while 42 F2 plants were susceptible, consistent with a 3:1 segregation ratio (χ23:1 = 1.71, P-value with 1 degree of freedom (P1df) >0.05). These findings confirm that PmNCA6 underlies the resistance observed in YangYF267.
3.2. PmNCA6 is localized to a 17-Mb recombination-suppressed interval on chromosome 7AL
Resistant (R) and susceptible (S) bulks were constructed from 600 F
2 plants derived from a YangYF267 × Yang09DPBZ cross for BSE-Seq analysis. Δ(SNP-index) analysis (threshold > 0.8) identified 501 candidate SNPs, with 479 SNPs mapped to a 583-699 Mb region on chromosome 7A (
Figs. 1(a) and
(b)), indicating that this region is associated with
PmNCA6-mediated resistance.
To further delimit the
PmNCA6 locus, ten InDel and five KASP markers (Table S5) were developed and used to genotype 1500 F
2 plants. Initial flanking markers,
7AK-560 and
7AID-713, detected only 25 recombinants, suggesting strong recombination suppression in this region. Combined genotyping and phenotyping localized
PmNCA6 to a 17-Mb interval (680.1-697.1 Mb) between markers
7AID-680 and
7AK-697 (
Fig. 1(c)).
3.3. MutExomeSeq identifies an NLR gene as the candidate for PmNCA6
Six independent EMS-induced susceptible mutants were identified from 800 M
2 families of YangYF267 (
Fig. 2(a)). Whole-exome capture sequencing of these mutants and the WT YangYF267 revealed 4977 SNPs within the target 17-Mb interval on WT when compared to the Chinese Spring reference genome. Among the 107 annotated genes in this region, 16 contained coding sequence mutations in at least one mutant. Notably, only
TraesCS7A03G1212700, designated
NLR1 and encoding an NLR protein, harbored non-synonymous mutations in all six mutants (
Figs. 2(b) and
(c), Table S6 in Appendix A), confirming it as the likely causal gene for
PmNCA6. Sanger sequencing of the
NLR1 CDS in these mutants using
P-exon-NLR confirmed the exome sequencing results.
The NLR1 gene, amplified from YangYF267, spans 9012 bp and comprises four exons and three introns (Fig. S2(a) in Appendix A). Three alternatively spliced transcripts were identified: NLR1_V1 (2823 bp; 940 aa), NLR1_V2 (2808 bp; 935 aa) containing a 15-bp deletion, and NLR1_V3 (2142 bp; 713 aa) with a 681-bp deletion relative to NLR1_V1 (Fig. S2 in Appendix A). Expression analysis revealed no significant differences in transcript abundance among the three splicing variants, and none were induced upon powdery mildew infection (Fig. S3 in Appendix A).
3.4. NLR1 confers powdery mildew resistance as PmNCA6 in transient and stable transgenic assays
BSMV-VIGS was performed to specifically silence the NBS and LRR domains of NLR1 (BSMV:
NLR1_NBS and BSMV:
NLR1_LRR) in YangYF267 seedlings to assess whether
NLR1 is required for the resistance conferred by
PmNCA6. Plants with silenced
NLR1 exhibited markedly reduced transcript levels and increased susceptibility to powdery mildew, while plants carrying the empty vector remained resistant (
Figs. 3(a) and
(b)), confirming that
NLR1 is essential for immunity.
To further assess
NLR1’s function, four constructs were transformed into the susceptible cultivar Fielder: a 13 516-bp genomic fragment containing
NLR1 with its native promoter and terminator (
PNLR1:
NLR1), and three splice variants driven by the maize (
Zea mays) Ubiquitin promoter (
Ubi:
NLR1_
V1,
Ubi:
NLR1_
V2, and
Ubi:
NLR1_V3).
Agrobacterium-mediated transformation yielded at least three PCR-positive T
0 plants per construct. In the T
1 progeny, resistance to isolate BgtYZ01 co-segregated with transgene presence in plants expressing
PNLR1:
NLR1,
Ubi:
NLR1_
V1, and
Ubi:
NLR1_
V2 (Figs. 3(c)-(e)). In contrast, plants expressing the truncated variant
Ubi:
NLR1_
V3 remained susceptible (
Fig. 3(f)), indicating that the 681-bp deletion in
NLR1_
V3 disrupts resistance function.
To verify that NLR1 confers resistance to multiple isolates, we inoculated T1 progeny from both the NLR1 overexpression and native promoter-driven transgenic lines in the susceptible Fielder background with 22 Bgt isolates (Table S4). All positive transgenic plants exhibited resistance to every isolate, whereas the Fielder control remained susceptible, confirming that NLR1 alone is sufficient to confer resistance. To confirm that NLR1 is necessary for the multi-isolate resistance observed in the donor line YangYF267, six independent pmnca6 EMS mutants were inoculated with the same set of 22 Bgt isolates (Table S4). All mutants lost resistance and displayed susceptibility comparable to the recurrent parent Yang09DPBZ, indicating that resistance in YangYF267 was entirely dependent on functional NLR1.
By integrating MutExomeSeq, VIGS, and transgenic complementation, we conclusively demonstrate that NLR1 is PmNCA6, the gene responsible for powdery mildew resistance in YangYF267.
3.5. PmNCA6 originated from T. boeoticum
Phylogenetic analysis of PmNCA6-like sequences across wheat genomes and their wild relatives placed PmNCA6 in a clade with Tm.TA299.r1.7AG0168310 from T. boeoticum accession TA299 (Fig. S4 in Appendix A), confirming its origin from T. boeoticum. Subsequently, we extracted all NLR genes from the T. boeoticum (TA299) reference genome and constructed a comprehensive phylogenetic tree including PmNCA6, Sr22a, TraesCS7A03G1212700, and these T. boeoticum NLRs. This analysis showed that PmNCA6, Sr22a, and TraesCS7A03G1212700 form a distinct, well-supported clade, strongly indicating their orthologous relationship (Fig. S5 in Appendix A). To further substantiate orthology, synteny analysis was performed on the 17-Mb resistance region harboring PmNCA6 in the T. boeoticum (TA299) genome and the corresponding region containing TraesCS7A03G1212700 in the Chinese Spring (v2.1) genome (Fig. S6 in Appendix A). The analysis revealed a clear, conserved syntenic relationship, confirming that PmNCA6 and TraesCS7A03G1212700 occupy orthologous genomic positions.
Exome sequencing data revealed an ∼80-Mb T. boeoticum introgression in YangYF267 spanning 623-703 Mb on chromosome 7A (Fig. S7 in Appendix A). Using RT-PCR, ten PmNCA6 alleles (PmNCA6a-j) were identified. PmNCA6a and PmNCA6b, which differ by 12 aa, were present in six and five resistant accessions, respectively, while PmNCA6c was unique to resistant accession PI 272519 (Fig. S8 in Appendix A). PmNCA6d occurred in both resistant and susceptible accessions, suggesting potential loss of function, whereas allelic PmNCA6e-j were exclusive to susceptible accessions and are likely non-functional (Table S2).
3.6. The LRR domain determines functional specificity of PmNCA6
TraesCS7A03G1212700/
PmNCA6 is a homolog of the wheat stem rust resistance gene
Sr22a [
38]. Sequence alignment showed 97% nucleotide and 95% protein identity between the
PmNCA6 and
Sr22a. Despite this similarity, transgenic wheat expressing
Sr22a remained susceptible to the
Bgt isolate BgtYZ01 (
Fig. 4), indicating that the two genes have distinct pathogen recognition specificities.
Comparative analysis revealed 50 aa differences between
PmNCA6 and
Sr22a, with 78% (39/50) of these differences located in the LRR domain (
Fig. 4(a)). To investigate the role of the LRR domain, two chimeric genes were engineered:
NCG1 (fusing
Sr22a’s CC-NBS with
PmNCA6’s LRR) and
NCG2 (fusing
PmNCA6’s CC-NBS with
Sr22’s LRR) (
Fig. 4(b)). Transgenic plants expressing
NCG1 conferred resistance to BgtYZ01, whereas those expressing
NCG2 remained susceptible (
Fig. 4(c)). These results demonstrate that the LRR domain of
PmNCA6 is both necessary and sufficient for the recognition of powdery mildew.
3.7. PmNCA6 and its diagnostic marker demonstrate breeding potential
To evaluate the agronomic performance of PmNCA6, an F2:8 RIL population derived from the YangYF267/Yang09DPBZ cross was analyzed. Resistant and susceptible lines showed comparable plant height, spike length, and grain number per spike. However, susceptible RILs produced significantly more spikelets per spike than resistant RILs (Table S7 in Appendix A). The NIL Yang24M105, carrying PmNCA6 in the Yang09DPBZ background, exhibited grain yield comparable to the recurrent parent Yang09DPBZ (Table S8 in Appendix A), indicating that PmNCA6 does not impose a yield penalty.
We also developed the diagnostic marker FM-NLR for PmNCA6 and screened 553 wheat varieties, including 435 commercial cultivars from the Huang-Huai Winter Wheat Region (HWWR) and 118 cultivars from the Middle and Lower Yangtze River Wheat Region (MLYRWR) (Table S1). None of these varieties carried PmNCA6, highlighting its potential to broaden the genetic basis of powdery mildew resistance in breeding programs.
4. Discussion
We identified and cloned PmNCA6 from the advanced breeding line YangYF267. This gene confers effective resistance to prevalent Bgt isolates in the MLYRWR region without affecting yield or other agronomic traits, thereby overcoming a key limitation in resistance gene deployment. Using the MutExomeSeq approach, we cloned PmNCA6 and validated its function through VIGS and stable transformation in Fielder. The gene PmNCA6 encodes an NLR protein orthologous to the stem rust resistance gene Sr22. Domain-swapping experiments revealed that the LRR domain determines pathogen recognition specificity.
We developed a diagnostic marker, FM-NLR, to facilitate the deployment of PmNCA6 in breeding programs. Screening a diverse array of wheat varieties revealed that PmNCA6 has not been previously used in current germplasm, demonstrating its potential to diversify resistance resources. The absence of yield penalties in NILs and the gene’s effectiveness against regional Bgt isolates position PmNCA6 as a prime candidate for wheat improvement.
Historically, powdery mildew resistance in the MLYRWR was largely conferred by
Pm2a and
Pm4a in cultivars like Yangmai 12 and Yangmai 13. By the 2010s, however, these resistance genes were rendered ineffective due to the evolving virulence of
Bgt [
5]. Resistance subsequently relied on
Pm21, introgressed via the wheat-
D. villosum translocation T6VS·6AL [
62], which now accounts for 95.9% of resistant lines in regional trials [
63]. This widespread dependence has resulted in genetic uniformity and increased vulnerability to resistance breakdown.
PmNCA6, derived from
T. boeoticum, is not affected by regional
Bgt isolates and lacks linkage drag, offering a more sustainable alternative.
Gene cloning in recombination-suppressed regions, such as chromosome 7AL, has long posed challenges for conventional map-based approaches. To address this, several advanced mutagenesis-sequencing strategies have been developed [
64]. These methods, often target specific chromosomes or gene classes, minimize genomic interference, and operate independently of genetic maps. For instance, MutRenSeq efficiently isolates NLR genes but is unsuitable for other gene types. Methods based on transcriptome sequencing, such as MutIsoSeq and STAM, are not limited by gene type, but require detectable expression. MutChromSeq is independent of both expression and gene type, yet it necessitates flow-sorting of the target chromosome. In contrast, MutExomeSeq overcomes these limitations, functioning independently of gene type, expression level, or chromosome sorting. Its main constraint is that the target gene, or a close homolog, must be present in the reference genome, making it unsuitable for cloning genes absent from the reference.
The LRR domain of
PmNCA6 determines its functional divergence from
Sr22. Domain-swap assays showed that replacing
Sr22’s LRR with
PmNCA6’s LRR (chimera
NCG1) conferred powdery mildew resistance, whereas the reciprocal chimera (
NCG2) did not, demonstrating the LRR’s critical role in pathogen recognition specificity. This reflects a broader pattern of NLR functional diversification driven by structural variation. For instance,
Yr87/Lr85 (NLR) confers dual resistance to yellow and leaf rusts [
65], while non-NLR genes such as
Pm38/
Lr34/
Yr18/
Sr57 (ATP-binding cassette transporter) and
Pm46/Lr67/Yr46/Sr55 (hexose transporter) confer resistance to multiple fungal pathogens [
11], [
12]. Allelic variants of homologous genes, including
Pm57/
Lr9 [
29], [
40],
Pm24/
Rwt4 [
10], [
66], and
Sr33/
Mla [
67], further illustrate how functional diversification enables pathogen-specific recognition, highlighting the evolutionary plasticity of resistance gene families.
The distal region of chromosome 7AL exhibits structural complexity and harbors multiple documented powdery mildew resistance genes [
68]. These include
Pm1a [
7],
Pm59 [
69], and
mlRD30 [
70] from
T. aestivum;
PmTb7A.1,
PmTb7A.2 [
71], and
Mlm80 [
72] from
T. boeoticum;
Pm37 [
73] and
MlAG12 [
74] from
T. timopheevii;
Pm60 from
T. urartu [
16];
MlUM15 [
75] from
Ae. neglecta; and
MlWE18 [
76],
MlIW72 [
77],
MlIW172 [
78],
HSM1 [
79], and
PmG16 [
80] from
T. dicoccoides. Additionally,
Mlm2033 [
71],
PmNCA4, and
PmNAG11 [
81] were identified from
T. monococcum.
To clarify the relationship between
PmNCA6 and these genes, we compared their physical intervals on chromosome 7A. Among them,
Pm1a,
Pm60, and
MlWE18 have been cloned, with
Pm60 and
MlWE18 confirmed as allelic [
82].
Pm1a is located at 732 Mb, while
Pm60/
MlWE18 resides at 733 Mb. Eleven of these genes, including
Pm59,
mlRD30,
MlUM15,
Mlm2033,
Mlm80,
PmTb7A.2,
MlAG12,
MlIW72, MlIW172,
HSM1, and
PmG16, are distributed between 713 and 745 Mb. Only
PmNCA4,
PmNAG11,
PmTb7A.1, and
Pm37 exhibit genomic intervals that overlap with or are physically close to
PmNCA6.
5. Conclusions
This study cloned PmNCA6 using the MutExomeSeq strategy and validated its function through BSMV-VIGS and stable transgenic assays. We demonstrated that PmNCA6 encodes an NLR protein orthologous to the stem rust resistance gene Sr22, with its LRR domain being critical for pathogen recognition specificity. The absence of yield penalties in NILs, combined with effective resistance against multiple isolates, positions PmNCA6 as a valuable resource for wheat breeding. The diagnostic marker FM-NLR developed in this study enables efficient marker-assisted selection for this gene. Our findings not only provide an immediate solution to powdery mildew threats in the MLYRWR but also establish a framework for the development of multi-resistant wheat cultivars.
PDF
(2544KB)
